ID: 973775609

View in Genome Browser
Species Human (GRCh38)
Location 4:54238663-54238685
Sequence CCAGTGATAAAACAGGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973775609 Original CRISPR CCAGTGATAAAACAGGTTGC AGG Intronic
902842707 1:19085574-19085596 CCTGTCATAAAACAGGCAGCTGG - Intronic
907488559 1:54794050-54794072 CCTGTTAAAACACAGGTTGCTGG - Intronic
911782110 1:101894054-101894076 CCAGTGATAATACTCGCTGCTGG + Intronic
911803689 1:102177661-102177683 ACAGTGATAAATCATGTTGCTGG - Intergenic
912311165 1:108622861-108622883 CCAGAGATAAAACAGGGAGGTGG - Intronic
912311435 1:108625150-108625172 CTTGTGAAAACACAGGTTGCTGG + Intronic
913064502 1:115238183-115238205 CCAGTGATAAAAATGGGTGGAGG + Intergenic
918553672 1:185773606-185773628 CAAGAGGTAGAACAGGTTGCAGG - Intronic
920594285 1:207253193-207253215 CCAGTCTTAAAAAATGTTGCTGG - Intergenic
920821203 1:209383057-209383079 TTGCTGATAAAACAGGTTGCAGG + Intergenic
922463586 1:225830857-225830879 GCTGTGCTAAAACAGGTAGCAGG - Intronic
923739435 1:236642027-236642049 TCAGTAATAAAACAGATTGCAGG + Intergenic
924174803 1:241379742-241379764 TTGCTGATAAAACAGGTTGCAGG + Intergenic
1063795447 10:9509267-9509289 ACATTGATAAAACAGGTAGTTGG + Intergenic
1065943628 10:30587464-30587486 CCAGAGAAAATACAGGATGCTGG + Intergenic
1066344146 10:34566027-34566049 CCAGTGATAACACAGGAGGACGG + Intronic
1070445589 10:76497902-76497924 TCAGAGATAAAACAAGTTGAAGG - Intronic
1079678444 11:23262436-23262458 CCAGTGATGAATCAGGTAGTAGG + Intergenic
1080022209 11:27574354-27574376 AAAGTGTTAAACCAGGTTGCAGG - Intergenic
1082811328 11:57480799-57480821 CCAGGGATAGACCAGGTGGCAGG + Intergenic
1084687213 11:70703691-70703713 CCAGTGACAACAAAGGATGCTGG + Intronic
1085278999 11:75318062-75318084 CTTGTTAAAAAACAGGTTGCTGG + Intronic
1086794236 11:91080893-91080915 AACGTGATAAAACAGGTTGGAGG + Intergenic
1087347559 11:96991018-96991040 CAAGTGGAAAAACAGCTTGCAGG - Intergenic
1090518589 11:127454878-127454900 CCAGTGTTTTGACAGGTTGCAGG - Intergenic
1091271255 11:134313321-134313343 TCAGTGAAAAAACGGGTTGTCGG + Intronic
1098437967 12:70488263-70488285 TTGCTGATAAAACAGGTTGCAGG - Intergenic
1099416835 12:82399335-82399357 GCAGTGATAAAAGAGGTTAAAGG - Exonic
1100112904 12:91267445-91267467 CCAGTGATAATACAGTTGGGGGG - Intergenic
1101365563 12:104066688-104066710 CCTGTGAAAACACAGATTGCTGG + Intronic
1105628262 13:22135156-22135178 TCAGTGAGAAAAGAGCTTGCAGG - Intergenic
1109096083 13:58118312-58118334 ACAGTGAGAAAACAGGTTGTAGG - Intergenic
1111562997 13:89977257-89977279 CTGCTGATAAAGCAGGTTGCAGG - Intergenic
1112649640 13:101380624-101380646 CAAATGATAAAACATGTTGCAGG + Intronic
1112698023 13:101972249-101972271 CCAGTGCTGAACGAGGTTGCTGG + Intronic
1119801972 14:77453584-77453606 CCAGTGATAAAAGAGTTAGGAGG + Intronic
1119876210 14:78061749-78061771 GCAGTGATAAGACATGTTGATGG - Intergenic
1120454286 14:84712352-84712374 ACATGGATAAAATAGGTTGCAGG + Intergenic
1122213138 14:100186055-100186077 CAGCTGATAAAACAGGATGCAGG - Intergenic
1123203345 14:106689267-106689289 CAATTGATAAAATAGGTTTCTGG + Intergenic
1124702210 15:31925748-31925770 CCAGAGATAAAAGCAGTTGCAGG + Intergenic
1128559020 15:68652379-68652401 CCAGTGGTTAATCAGGCTGCTGG - Intronic
1130308597 15:82732927-82732949 TTGCTGATAAAACAGGTTGCAGG + Intergenic
1132130233 15:99270465-99270487 CCAGAGAGAAAACAGATTGCTGG - Intronic
1132151340 15:99462079-99462101 CCAGTGACAAATCATGTTGATGG + Intergenic
1133018883 16:2957428-2957450 CCAGAGAAAAGACTGGTTGCTGG + Intergenic
1137277189 16:46943403-46943425 CTACTGATAAGACAGGATGCGGG - Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138868350 16:60850537-60850559 CCAGTGACACAAAAGGCTGCCGG + Intergenic
1139377225 16:66507489-66507511 CCAGAGACAAAATAGGTTGGTGG - Intronic
1141288164 16:82691915-82691937 CTTGTGAAAATACAGGTTGCTGG - Intronic
1143890491 17:10098661-10098683 ACACAGATAAAACAGGTGGCCGG + Intronic
1144953714 17:19008122-19008144 CTATAGATAAAACTGGTTGCAGG + Intronic
1146008133 17:29174920-29174942 TAAGTGAAAAAATAGGTTGCAGG + Intronic
1146770863 17:35567798-35567820 CCAGTTATGAAACAGGGTACAGG + Intergenic
1146814889 17:35934783-35934805 CCTGAGATGAAACAGGGTGCGGG - Exonic
1146832851 17:36084781-36084803 CTTGTGAAAACACAGGTTGCTGG + Intergenic
1146847324 17:36191082-36191104 CTTGTGAAAACACAGGTTGCTGG + Intronic
1149922123 17:60669765-60669787 TAACTAATAAAACAGGTTGCGGG - Intergenic
1150038497 17:61831379-61831401 TAAGTGATATAACAAGTTGCAGG + Intronic
1151480711 17:74368800-74368822 CCAGGGAAACAACAGCTTGCAGG + Intronic
1151534216 17:74729615-74729637 CCAGGGACAAAGCAGGCTGCTGG + Intronic
1152459123 17:80432143-80432165 CCGGTGAGGAAACAGGTTCCAGG - Intronic
1155571932 18:27204077-27204099 CAATTGGTAAAACAGGTTGCTGG - Intergenic
1156398424 18:36719530-36719552 CCAGTTTTAAAACAGGTTTAAGG + Intronic
1159124162 18:64203568-64203590 CCAGTCATAAAACACATTGTAGG - Intergenic
1164142629 19:22486715-22486737 CCAGTTATAAATCAGGTTAAAGG - Intronic
1165857402 19:38888048-38888070 CGAATTATAAAACAGGTGGCCGG - Intronic
925272165 2:2619376-2619398 CCAGTTATACAACAGGTATCAGG + Intergenic
926911492 2:17855757-17855779 CCAGAGAAGAAACAGGATGCAGG + Intergenic
927028958 2:19100680-19100702 CAAGTCATAAAAAAAGTTGCTGG - Intergenic
930469355 2:51793292-51793314 TCAGAGATACAACAGGTTGTAGG + Intergenic
933230210 2:79798147-79798169 CCAGTTAAAATACAGATTGCTGG - Intronic
934927115 2:98389699-98389721 CCAGCGGTAGTACAGGTTGCTGG - Exonic
935939386 2:108222312-108222334 CCTGTCAAAACACAGGTTGCTGG - Intergenic
940726279 2:157340260-157340282 TTGCTGATAAAACAGGTTGCAGG - Intergenic
942195302 2:173512127-173512149 CCTGAGATAAAACTGGTTTCAGG - Intergenic
943417624 2:187629141-187629163 CTAGTGATTAGACAGGTTGAAGG - Intergenic
943834450 2:192500972-192500994 CCAGTGCTAAAGCAGCTGGCTGG + Intergenic
948148663 2:235727703-235727725 ACACCGATAAAACAGGTTGGGGG - Intronic
948628473 2:239285181-239285203 ACAGTGAGAAAACAGGCAGCTGG + Intronic
1169273653 20:4218828-4218850 TTGCTGATAAAACAGGTTGCAGG + Intergenic
1171070739 20:22065899-22065921 CCAGTGAAAACACAGATTGCTGG + Intergenic
1171403664 20:24895157-24895179 CCACAGATAAAACTGGTTTCAGG - Intergenic
1174582777 20:51584206-51584228 CAGGTGATAAAACAGGCTGAGGG + Intergenic
1181278004 22:21698876-21698898 GCAGGGATAAAGCAGCTTGCAGG + Exonic
949964760 3:9346146-9346168 CATGTGAAAACACAGGTTGCTGG + Intronic
954958796 3:54546479-54546501 CCATTGATAAAACACTTTGGAGG + Intronic
955380839 3:58436571-58436593 TTGCTGATAAAACAGGTTGCAGG - Intergenic
955381193 3:58439753-58439775 TTGCTGATAAAACAGGTTGCAGG - Intergenic
955596964 3:60601309-60601331 CTTGTGATAAAACAGGTTACTGG + Intronic
955701047 3:61682503-61682525 CCAGTGAGGAAAAAGGTAGCTGG + Intronic
956159879 3:66339135-66339157 CCACTGATAAAACAATTTGATGG - Intronic
957313613 3:78549692-78549714 CCAGTGGTGATACAGGTTGTAGG - Intergenic
958006336 3:87816215-87816237 CAAGTGATAAGACAGGATGAGGG - Intergenic
959312105 3:104751803-104751825 CCAGGAATAAAACAGTTTGGGGG + Intergenic
961063110 3:123849591-123849613 GCAGTAAGAAAACAGTTTGCCGG + Intronic
961252585 3:125519835-125519857 TCAGTGGAAAAACAGGGTGCTGG - Intronic
962064117 3:131961348-131961370 CCAGTGATAAAACAGGCTCAGGG - Intronic
964246881 3:154664143-154664165 CCAGTAATAAAGGAGGTTGCGGG + Intergenic
969017209 4:4111376-4111398 CGAGAGAGAAAACAGGTTTCGGG + Intergenic
969106098 4:4808120-4808142 CCAGGGAGAGAACAGGTGGCTGG + Intergenic
969910885 4:10444707-10444729 CCAGAGAAGGAACAGGTTGCAGG + Exonic
969987492 4:11226703-11226725 CTAGTTATCAATCAGGTTGCAGG + Intergenic
971759260 4:30744120-30744142 ACAGTGAGAAAACAGCTTGGCGG - Intronic
972282174 4:37612889-37612911 CCAGTGTCAAAATAGGATGCAGG + Exonic
972339475 4:38138884-38138906 CCAGTGCCTAAACAGGTGGCTGG + Exonic
972398609 4:38679390-38679412 CAAGTGATAACACATGTTGCTGG + Intronic
973307807 4:48672663-48672685 GAAGTGATAAAAAAGGTTGCTGG - Intronic
973775609 4:54238663-54238685 CCAGTGATAAAACAGGTTGCAGG + Intronic
978486916 4:109264758-109264780 CCAATGATATCACATGTTGCTGG - Intronic
978649220 4:110980335-110980357 CCAGTGAGAAAGCAGTTTGGTGG + Intergenic
982680879 4:158427965-158427987 CCAAAGATAAAACAGTTTTCGGG - Intronic
987108038 5:14660190-14660212 TCAGTGATAAATCATGTTGATGG - Intergenic
988194490 5:27985273-27985295 ACAGTGATAAATCATGTTGATGG - Intergenic
989384585 5:40842739-40842761 CCAGTGAAATAAGAGGTGGCTGG + Intronic
989385286 5:40849384-40849406 GCAGTGAGAGAATAGGTTGCAGG - Intronic
990433783 5:55766717-55766739 CAAGTGACCAAACAGCTTGCAGG - Intronic
997760086 5:136437844-136437866 ACAGTGATAAATCATGTTGCTGG - Intergenic
998704678 5:144745069-144745091 CCAGAGATAAAACAAGAAGCTGG - Intergenic
999269047 5:150285824-150285846 CCAGTGATGACACAGGCTGCAGG + Intronic
1001204227 5:169746941-169746963 CCTGACATAAAACAGGTTGTTGG + Intronic
1002826718 6:780836-780858 CCAGCGATGAAACAGAGTGCTGG - Intergenic
1003067835 6:2918571-2918593 CCGCTGATAAAACAGGATGCAGG + Intergenic
1003733373 6:8850904-8850926 CCCGTGAAAACACAGATTGCTGG + Intergenic
1004338657 6:14787593-14787615 AGAGAGATAAAACAGTTTGCTGG - Intergenic
1005200775 6:23341774-23341796 CCATTGAGGAAACAGGTTGGAGG + Intergenic
1008613569 6:53205742-53205764 CCAGTGACCCAACAGGGTGCAGG - Intergenic
1008686451 6:53930783-53930805 GCAGTGTTAAAGCAGATTGCTGG + Intronic
1012233358 6:96785579-96785601 CCAGTGATAAAAGAGATACCAGG - Intergenic
1014511860 6:122332255-122332277 CCAGTGCTACCACAGGATGCTGG - Intergenic
1020668346 7:11074618-11074640 AGAGTGATAACACAGGTTTCTGG - Intronic
1020951957 7:14690565-14690587 CATGTGCAAAAACAGGTTGCTGG - Intronic
1021071065 7:16241818-16241840 CCAGTGATAAAGGAGATTTCAGG - Intronic
1021362939 7:19739016-19739038 ACAGTGATAAATCATGTTGATGG + Intronic
1021397987 7:20173780-20173802 CCAGTACTAAAACAGGTTCATGG - Intronic
1021822379 7:24510997-24511019 CCAGTGGTAGAACAGGCTTCAGG + Intergenic
1022329685 7:29365855-29365877 CCAGGGAAAAAACAGGCTGCAGG + Intronic
1024038216 7:45526579-45526601 CCTGTTAAAAAACAGATTGCTGG + Intergenic
1024825534 7:53385910-53385932 CTGCTGATAAAACAGGTAGCAGG + Intergenic
1026443664 7:70465355-70465377 CCAGTGAAAAATCAGGCTTCAGG + Intronic
1028941414 7:96526227-96526249 ACAGTGATAAAACAGTTCTCTGG + Intronic
1034507827 7:151509166-151509188 CCAGAGACAAATGAGGTTGCTGG - Intronic
1034782149 7:153890417-153890439 CCGGTGAAACAACAGGCTGCAGG - Intronic
1037884738 8:22589996-22590018 CGAGTGATAAAAGCGGTGGCAGG + Intronic
1038167222 8:25097518-25097540 CCAGTGAGAAAACAGTTCACTGG + Intergenic
1038788887 8:30649208-30649230 TCAGTTATAAAACAGCTTGTAGG + Intronic
1040579537 8:48686187-48686209 CCAGAAATAAGACAGGTTTCAGG + Intergenic
1042881715 8:73499811-73499833 CCAGTGAGAAAACAAGTCCCAGG + Intronic
1043561690 8:81500832-81500854 ACAGCAACAAAACAGGTTGCTGG + Intergenic
1043678714 8:82995148-82995170 CCATGGATAAAACTGGTTTCAGG + Intergenic
1045643957 8:104282080-104282102 CCACTGATAAAGCAGGATGCGGG - Intergenic
1047093433 8:121597939-121597961 CCAGTGATAACACAGGCCGTAGG + Intergenic
1048174324 8:132138114-132138136 CCAAAGATAAAAGAGCTTGCTGG + Intronic
1049794382 8:144489809-144489831 CCAGCCATAAAGCAGGTTGGTGG - Intronic
1051583843 9:18706367-18706389 CCACTAATAAAATAGGATGCTGG - Intronic
1051590870 9:18776099-18776121 CCACTGGAAAAACAGTTTGCAGG + Intronic
1052291901 9:26851674-26851696 CCACTGATTAAACAGGGTTCTGG + Intronic
1052891395 9:33703770-33703792 CTGCTGATGAAACAGGTTGCAGG + Intergenic
1057591542 9:96377339-96377361 CTAGAGATAAAACTGGTTTCAGG - Intronic
1059708597 9:116846709-116846731 CCAGTGAGAAAAGTGGTAGCTGG + Intronic
1186400859 X:9258187-9258209 CCAGAGATAAAACAGGAGGCTGG - Intergenic
1186833474 X:13414340-13414362 TTGCTGATAAAACAGGTTGCAGG - Intergenic
1187067970 X:15859415-15859437 CTTGTGAAAATACAGGTTGCTGG + Intergenic
1188513150 X:30958299-30958321 CCACTTATAAAAGAGGTTGAAGG + Intronic
1193348802 X:80433326-80433348 GCAGTGAAAAATCAGGCTGCAGG - Intronic
1197692672 X:129520699-129520721 TCAGTGATAAAACAGGGAGAGGG - Intronic
1197963043 X:132026164-132026186 TAAGTGATAGAACAGGTAGCTGG - Intergenic