ID: 973777625

View in Genome Browser
Species Human (GRCh38)
Location 4:54257598-54257620
Sequence GACTCAAGAAGCCACACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973777625_973777629 -3 Left 973777625 4:54257598-54257620 CCCTCAGTGTGGCTTCTTGAGTC 0: 1
1: 0
2: 1
3: 14
4: 158
Right 973777629 4:54257618-54257640 GTCAATACCTGGGTACTTACTGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973777625 Original CRISPR GACTCAAGAAGCCACACTGA GGG (reversed) Intronic
903904747 1:26676724-26676746 GACTCATCAAGACACACTGAGGG + Intergenic
905979503 1:42210976-42210998 GACAAAAGAAGCCAGACTGCAGG + Intronic
906848013 1:49215638-49215660 GTCTGAAGAATCCACAGTGATGG - Intronic
907786899 1:57621415-57621437 AACTCATGAACCCTCACTGAAGG + Intronic
907830438 1:58059880-58059902 GACTCCAGAGGCTACACTCACGG + Intronic
908707216 1:66971356-66971378 ATCTCAAGAAGCCACAAAGAAGG + Intronic
908835183 1:68222801-68222823 GATTCAAGTAGCCACACTCATGG + Intronic
910843568 1:91584665-91584687 GAGTCAAGAAGACAATCTGAGGG - Intergenic
915487818 1:156234295-156234317 GACTGAAGAAGCCTTCCTGAGGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
917506146 1:175628855-175628877 GCCACAAGAAGCCCCACTGCAGG - Intronic
922873775 1:228923955-228923977 CACTCAGGAAGCTAAACTGAGGG - Intergenic
923013734 1:230109525-230109547 GACTTAAGAAGGAACACTGTTGG + Intronic
924946284 1:248849096-248849118 GAGTCAAGAAGCCACAGGGCTGG - Exonic
1063346234 10:5314753-5314775 AATTCATCAAGCCACACTGATGG + Intergenic
1066950288 10:42111118-42111140 GGGACAAAAAGCCACACTGAGGG + Intergenic
1068825695 10:61436186-61436208 AATTCAAGAAGCCATAATGATGG + Exonic
1072836009 10:98713043-98713065 GACTCAAGAAAGCACTCTGATGG + Intronic
1074773605 10:116749690-116749712 GACTCATGTAGCGGCACTGAGGG + Intergenic
1076542748 10:131224365-131224387 GACTCAAGAGGCCAGAGTGCAGG - Intronic
1079448807 11:20581437-20581459 GAGTCATGAAGTCCCACTGAAGG - Intergenic
1082626593 11:55494762-55494784 TACTCAAGGAACCACACTGCAGG - Intergenic
1084879564 11:72160627-72160649 CACTCAAGAACCCACGCTGATGG + Intergenic
1085504048 11:77046015-77046037 GACTCAAGAAGCCGCCGTTATGG + Intergenic
1086197989 11:84165132-84165154 GCCTCATGGAGCCATACTGAGGG - Intronic
1089393630 11:118118849-118118871 AATGTAAGAAGCCACACTGAGGG - Exonic
1089630340 11:119780307-119780329 GACTCAGGAAACCACACACATGG - Intergenic
1090570168 11:128037076-128037098 GACTCAGCAAGCCATAATGAGGG - Intergenic
1091181655 11:133610013-133610035 TCCTCAAGAAGCCACACCTAAGG - Intergenic
1091702779 12:2674744-2674766 GACTCAAGAAGCAAGTCTCAGGG - Intronic
1092625353 12:10321311-10321333 TACTCAAGAAGCTAAACTTAAGG + Intergenic
1092674584 12:10901442-10901464 GACACAAGCACCAACACTGAGGG - Intronic
1099681693 12:85837142-85837164 GAGTAAAGAAGACACACCGAGGG + Intergenic
1099774716 12:87110650-87110672 GACTCAAGGATGCAAACTGAGGG - Intergenic
1102778615 12:115543308-115543330 GACTCAAGAAGCTGTACTGGAGG - Intergenic
1104067085 12:125315039-125315061 GACTCAAGAAGGCACCCTCCTGG + Intronic
1104470844 12:129028477-129028499 GAATGAAGAAGCCACACAGGAGG - Intergenic
1107118034 13:36768043-36768065 GACTCAGGAAGGAACACTGCAGG - Intergenic
1107481964 13:40792645-40792667 GGCTGAAGGAGCCACACTGCAGG + Intronic
1108423805 13:50277772-50277794 CACTCAAGAATTCACCCTGATGG + Intronic
1108468397 13:50742504-50742526 AACACAGGAAGCCACACTCAGGG + Intronic
1109065133 13:57677639-57677661 TACGCAAGAAGACACACTGTCGG + Intronic
1110760302 13:79223700-79223722 TACTCCAGAATCCACACTGGTGG + Intergenic
1111835792 13:93386911-93386933 GACAGAAGAAGACACACGGAAGG - Intronic
1113111237 13:106826285-106826307 TACTCAAGAAACCACATTTAAGG + Intergenic
1113830271 13:113290315-113290337 GAGTCCCGCAGCCACACTGAAGG - Intergenic
1116177336 14:41488765-41488787 CACTCAAGCAGCATCACTGAAGG + Intergenic
1117464430 14:55978169-55978191 GACTCCAGAACCCAGACTGTGGG + Intergenic
1117485205 14:56189319-56189341 AATTCAGGAAGCCACACTGATGG + Intronic
1118695203 14:68377766-68377788 GACTCCCTAAGCCACACAGATGG - Intronic
1119035171 14:71223633-71223655 GACTCCAGAACCAAAACTGATGG + Intergenic
1119130707 14:72170021-72170043 GCTTCAAGAAGCCACACTCCTGG - Intronic
1119803035 14:77462485-77462507 GACTCAAGAAGGAACACTAATGG + Intronic
1121097104 14:91225087-91225109 GCCTGAAGAAGCCAGAGTGAAGG - Exonic
1128830811 15:70766938-70766960 GAATAAAGAATCCACACAGAGGG + Intergenic
1129650467 15:77483631-77483653 CAATCACAAAGCCACACTGAGGG - Exonic
1134599191 16:15520059-15520081 GACTCAAGAAGCTAAAATTAAGG - Intronic
1141143947 16:81515889-81515911 GTCTCCAGAGGCCACTCTGATGG + Intronic
1142969616 17:3602452-3602474 GACCCAGAAAACCACACTGATGG - Intergenic
1149643835 17:58224530-58224552 GACTCATCTAACCACACTGAAGG + Intronic
1150594015 17:66588241-66588263 CACAGAAGAAGCAACACTGATGG - Intronic
1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG + Exonic
1156664249 18:39385988-39386010 GACTGAAGGAGGCAAACTGAAGG - Intergenic
1158014629 18:52769360-52769382 GACCAAAGAAGACACACTGGTGG - Intronic
1158289773 18:55926890-55926912 GAGTTAAGAAGGCACAGTGACGG + Intergenic
1159530859 18:69653467-69653489 GGCTGAAGAAGCCAAGCTGAAGG + Intronic
1159995403 18:74959923-74959945 GCATAAAGAAGCCACACTGTTGG - Intronic
1160160308 18:76465715-76465737 CACGCAAGAACCCAAACTGAGGG + Intronic
1164721565 19:30435885-30435907 GACTCCAAAAGCCACAGTGATGG + Intronic
1166566717 19:43770042-43770064 CATTCAAGAGGCCACCCTGAGGG - Intronic
925304125 2:2836991-2837013 GACTGAAAAACCCACTCTGAGGG + Intergenic
928438505 2:31272018-31272040 AACTTAAAAAGTCACACTGAAGG - Intergenic
928728662 2:34205830-34205852 GAATCAAGCAGCTAAACTGATGG + Intergenic
930019450 2:46992568-46992590 GCCTCAGGAAGCTACGCTGAGGG + Intronic
931082893 2:58795300-58795322 AAGCCAAAAAGCCACACTGAGGG - Intergenic
931149709 2:59559550-59559572 CACTGAAGGTGCCACACTGAAGG - Intergenic
934247808 2:90323396-90323418 GACGCAAAAAGCCACAGTGGCGG + Intergenic
934261524 2:91479251-91479273 GACGCAAAAAGCCACAGTGGCGG - Intergenic
937564550 2:123268232-123268254 TACTTCAGAATCCACACTGATGG - Intergenic
946724842 2:222652145-222652167 TACTAAAGAAGCTATACTGAAGG + Intronic
948155213 2:235776197-235776219 CATTCATTAAGCCACACTGATGG - Intronic
948504815 2:238421720-238421742 GTCTCCAGGAGCCACACCGAGGG - Intergenic
948842812 2:240664006-240664028 GACACAAAAACCCACACTGGTGG - Intergenic
1168953205 20:1816843-1816865 GGCTCAGGAACCAACACTGAGGG - Intergenic
1169039742 20:2483158-2483180 GACACCAGAGGACACACTGACGG - Exonic
1174113919 20:48214235-48214257 GAGTGGAAAAGCCACACTGAGGG - Intergenic
1174167925 20:48598298-48598320 GAGTGGAAAAGCCACACTGAGGG + Intergenic
1175241397 20:57552175-57552197 GCCTCCAGAACCCACACTGTTGG + Intergenic
1176984567 21:15421041-15421063 GACTCCAGCAGCAACACTGCTGG + Intergenic
1179044438 21:37831942-37831964 GACAGTAGAAGGCACACTGATGG + Intronic
1179934859 21:44596327-44596349 GACACAAGGAGCCACAGAGAGGG - Intronic
1181969774 22:26681349-26681371 CACTCAAGAAGCCACAGTCATGG + Intergenic
1184191313 22:42896907-42896929 TACTCAAGAAGGCATACAGATGG - Intronic
1184892572 22:47388942-47388964 GGCTCAAGGACCCCCACTGAGGG + Intergenic
949988136 3:9555340-9555362 GTCTCAAGAAGCCAAATGGAAGG - Intergenic
953739504 3:45525098-45525120 GAATTAAGAAGCAACTCTGAGGG - Intronic
955984641 3:64559958-64559980 GAATCAAGAGGTCACACTGAGGG + Intronic
956404077 3:68909862-68909884 GTCTCAAGAAGCTGCACTCAAGG + Intronic
957926253 3:86816064-86816086 GAATGAATAAGCCAAACTGATGG + Intergenic
962467415 3:135673489-135673511 GACTCAGGAAGTCAGGCTGAAGG + Intergenic
962468726 3:135686348-135686370 GACTGAAGAAGAGACACTCATGG - Intergenic
964189064 3:153980830-153980852 CTCACAGGAAGCCACACTGATGG + Intergenic
968969704 4:3787352-3787374 GTCTGAAGAGGCCACACTGCAGG - Intergenic
970614589 4:17756298-17756320 GACTCAGGAGCCAACACTGAAGG + Intronic
971433636 4:26595218-26595240 GACTAAAGAAGACACACAGATGG - Intronic
973777625 4:54257598-54257620 GACTCAAGAAGCCACACTGAGGG - Intronic
973908467 4:55553999-55554021 GACTTAATAACCCACACTGTGGG + Intergenic
978854815 4:113382312-113382334 GACTCCAACAGCCACTCTGAGGG + Exonic
980083409 4:128367790-128367812 GACTCAGGAAGCCTGACTTAGGG - Intergenic
981582785 4:146267293-146267315 GATCCAAAAAGCCACACTGTAGG - Intronic
981781284 4:148433149-148433171 CACTCAAGAAGCCCTCCTGATGG - Intronic
982578988 4:157154074-157154096 GCCTCAAGAAGCCTCCCTGAAGG - Intronic
986124854 5:4875465-4875487 GCCTCAGGAAGCCACAATCATGG + Intergenic
986223667 5:5793269-5793291 GGCTCATGAGGACACACTGATGG + Intergenic
986944421 5:12998423-12998445 CACTCAAGGAGCCAGGCTGATGG - Intergenic
987729171 5:21745653-21745675 TACTCAAGAAGCAAGAATGAAGG - Intergenic
987737840 5:21868379-21868401 GTCTCAAGAAACCAAACTGTAGG + Intronic
989014500 5:36914011-36914033 AGCTCCAGAAACCACACTGATGG + Intronic
991227194 5:64286694-64286716 AACTGAAGAAGCCACACTTTTGG - Intronic
994540647 5:101091701-101091723 TACTCAAGGAGCTACACTGGAGG - Intergenic
994993527 5:107029618-107029640 GGCTAAAGAAGCTACACTGCCGG - Intergenic
997842040 5:137250655-137250677 GCCTCAAGAGGACACACGGATGG + Intronic
998243711 5:140475739-140475761 GACTCCAAGAGCCAGACTGAGGG + Intronic
1001369960 5:171189546-171189568 GATTCCAGGAGCCACAATGACGG - Intronic
1003331155 6:5129825-5129847 TACTCCACCAGCCACACTGAAGG + Intronic
1005412607 6:25566158-25566180 GACTGCAGAAGCAACAGTGAAGG - Intronic
1009356046 6:62746935-62746957 GACTCAACCATCCACACTAATGG - Intergenic
1011344932 6:86358650-86358672 GACTCAACCACCCACACTAATGG + Intergenic
1012760094 6:103290021-103290043 GACTCAACTGCCCACACTGAAGG + Intergenic
1013677932 6:112487980-112488002 GGCTCAGGAAGCCCCACTGGAGG + Intergenic
1018242142 6:161788072-161788094 GCCTGCAGAAGCTACACTGATGG - Intronic
1019626110 7:2016447-2016469 GACTCAGGAGGCCGCACGGAAGG - Intronic
1020056200 7:5118913-5118935 GCCTCAAGAAGCCACAGATAAGG - Intergenic
1021456453 7:20834422-20834444 AACACAAGAAGGAACACTGATGG + Intergenic
1022092633 7:27117532-27117554 GACCCAAGAAGCCAGACCCAAGG - Intronic
1023628725 7:42141839-42141861 TGGTCAAGAAGCCACTCTGATGG + Intronic
1023856015 7:44184621-44184643 GACCCAGGGAGCCACACTGTGGG + Intronic
1024042572 7:45566744-45566766 GTCCCAAGAATCCACACTCAAGG + Intergenic
1025188248 7:56877414-56877436 GCTGCAAGAAGCCACACTGAAGG - Intergenic
1025683678 7:63699506-63699528 GCTGCAAGAAGCCACACTGAAGG + Intergenic
1026172627 7:67967570-67967592 GAGTAAAGAAGCCACACCTAGGG - Intergenic
1027162302 7:75811714-75811736 GCCTGGAGAAGCCACAGTGATGG - Exonic
1027231393 7:76274698-76274720 GGCTCATCCAGCCACACTGAGGG + Intronic
1027636955 7:80688328-80688350 CACTCAAGAAGCCAAGCTGATGG - Intergenic
1029976068 7:104835053-104835075 GACTCCAGAGACCACACTGGAGG - Intronic
1032646259 7:133827972-133827994 GAGTAAAGGAGCCCCACTGATGG + Intronic
1033537561 7:142326107-142326129 GACTCAGGAAGCCACAGAAATGG + Intergenic
1040023736 8:42763137-42763159 GAACCATGAAGCAACACTGAGGG + Intronic
1040676739 8:49758940-49758962 GACTGCAGAAGCCACAGAGAAGG + Intergenic
1041700499 8:60783755-60783777 GACTTAGGATGCCACACTGGGGG + Intronic
1041983654 8:63893930-63893952 GACTGTAGAAGCCACACTTTAGG - Intergenic
1042259839 8:66847042-66847064 GCTTCAGGAAGCCACACTGCAGG + Intronic
1042752846 8:72177115-72177137 GACTAATGTAGCCATACTGAAGG - Intergenic
1044123348 8:88425489-88425511 GACTCAAGAAGTCATCTTGAAGG - Intergenic
1046827914 8:118712009-118712031 GACTCAAGTAGCCACTCTGATGG - Intergenic
1048874390 8:138825693-138825715 GACTCCAGCAGTCACACTCATGG - Intronic
1050124126 9:2338892-2338914 CACTCAAGGACCCAGACTGATGG - Intergenic
1051213950 9:14776226-14776248 GACACAAGAATCCATGCTGAAGG - Intronic
1053424967 9:38004577-38004599 GACTCCAGAACCCAGCCTGAGGG + Intronic
1057064775 9:92038568-92038590 CACTCAGGAAGCCACATTGCAGG - Intronic
1057111290 9:92473884-92473906 GACTCATGAAGTGACCCTGATGG + Intronic
1059667403 9:116461708-116461730 CACTCAGGGATCCACACTGATGG - Intronic
1059951032 9:119462644-119462666 GACTCCCCAAGCCACACTCATGG + Intergenic
1062468887 9:136693589-136693611 GAGTCCAGAGGCCACAGTGAGGG + Intergenic
1189096002 X:38140356-38140378 AACTGAAGAAGGGACACTGAGGG - Intronic
1192274397 X:69615493-69615515 GACTCAAGCAGCCTCACTCCTGG - Intergenic
1193608428 X:83597479-83597501 GACATACCAAGCCACACTGAGGG + Intergenic
1195173465 X:102291880-102291902 GACTCTAGAATGCATACTGAAGG - Intergenic
1195185400 X:102395216-102395238 GACTCTAGAATGCATACTGAAGG + Intronic
1195941291 X:110169988-110170010 GACACTAGAAGCCATGCTGAGGG - Intronic
1196831597 X:119780093-119780115 CACTCAAGAAGGCATGCTGATGG - Intergenic
1198516300 X:137411287-137411309 GACTAAAGAAGACATGCTGATGG - Intergenic
1200831044 Y:7689227-7689249 GACTCCAGAATCTACACTGGAGG - Intergenic
1201593706 Y:15642866-15642888 TACTAAAGCAGCCACACAGAAGG + Intergenic