ID: 973784166

View in Genome Browser
Species Human (GRCh38)
Location 4:54319510-54319532
Sequence CTTTCTGCCCAAAGGCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973784166_973784170 -6 Left 973784166 4:54319510-54319532 CCAGGTAGCCTTTGGGCAGAAAG No data
Right 973784170 4:54319527-54319549 AGAAAGACCAGGTTGGATTTTGG No data
973784166_973784173 18 Left 973784166 4:54319510-54319532 CCAGGTAGCCTTTGGGCAGAAAG No data
Right 973784173 4:54319551-54319573 CTTCACATACCTCCTTTGTCAGG No data
973784166_973784174 26 Left 973784166 4:54319510-54319532 CCAGGTAGCCTTTGGGCAGAAAG No data
Right 973784174 4:54319559-54319581 ACCTCCTTTGTCAGGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973784166 Original CRISPR CTTTCTGCCCAAAGGCTACC TGG (reversed) Intergenic
No off target data available for this crispr