ID: 973785059

View in Genome Browser
Species Human (GRCh38)
Location 4:54325718-54325740
Sequence TCTCAGATGGGGCAGCTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973785049_973785059 16 Left 973785049 4:54325679-54325701 CCCAGACGGGGTGGCTGCCGGGC 0: 383
1: 2795
2: 3660
3: 3527
4: 3258
Right 973785059 4:54325718-54325740 TCTCAGATGGGGCAGCTACTGGG No data
973785046_973785059 24 Left 973785046 4:54325671-54325693 CCTCACTTCCCAGACGGGGTGGC 0: 1882
1: 2591
2: 6222
3: 11614
4: 5578
Right 973785059 4:54325718-54325740 TCTCAGATGGGGCAGCTACTGGG No data
973785053_973785059 -1 Left 973785053 4:54325696-54325718 CCGGGCGGAGAGGCTCCTCACTT 0: 275
1: 2694
2: 8362
3: 5948
4: 4283
Right 973785059 4:54325718-54325740 TCTCAGATGGGGCAGCTACTGGG No data
973785050_973785059 15 Left 973785050 4:54325680-54325702 CCAGACGGGGTGGCTGCCGGGCG 0: 816
1: 1324
2: 2195
3: 2885
4: 2723
Right 973785059 4:54325718-54325740 TCTCAGATGGGGCAGCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973785059 Original CRISPR TCTCAGATGGGGCAGCTACT GGG Intergenic
No off target data available for this crispr