ID: 973801666

View in Genome Browser
Species Human (GRCh38)
Location 4:54484463-54484485
Sequence TCTCATCTGCATGGGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973801666_973801675 5 Left 973801666 4:54484463-54484485 CCAACCACCCCATGCAGATGAGA No data
Right 973801675 4:54484491-54484513 TCATGCGGGCATCTTTCCAAAGG No data
973801666_973801671 -10 Left 973801666 4:54484463-54484485 CCAACCACCCCATGCAGATGAGA No data
Right 973801671 4:54484476-54484498 GCAGATGAGACCCAGTCATGCGG No data
973801666_973801672 -9 Left 973801666 4:54484463-54484485 CCAACCACCCCATGCAGATGAGA No data
Right 973801672 4:54484477-54484499 CAGATGAGACCCAGTCATGCGGG No data
973801666_973801677 24 Left 973801666 4:54484463-54484485 CCAACCACCCCATGCAGATGAGA No data
Right 973801677 4:54484510-54484532 AAGGCGTTGCAGTTGAGAGTAGG No data
973801666_973801678 30 Left 973801666 4:54484463-54484485 CCAACCACCCCATGCAGATGAGA No data
Right 973801678 4:54484516-54484538 TTGCAGTTGAGAGTAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973801666 Original CRISPR TCTCATCTGCATGGGGTGGT TGG (reversed) Intergenic
No off target data available for this crispr