ID: 973802001

View in Genome Browser
Species Human (GRCh38)
Location 4:54487430-54487452
Sequence CTGTGAACTTACATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973802001_973802006 9 Left 973802001 4:54487430-54487452 CCTTCCACCATGTAAGTTCACAG No data
Right 973802006 4:54487462-54487484 ACCATCTATGAGCCAGAAAGTGG 0: 5
1: 26
2: 112
3: 311
4: 654
973802001_973802008 10 Left 973802001 4:54487430-54487452 CCTTCCACCATGTAAGTTCACAG No data
Right 973802008 4:54487463-54487485 CCATCTATGAGCCAGAAAGTGGG 0: 8
1: 50
2: 218
3: 472
4: 944

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973802001 Original CRISPR CTGTGAACTTACATGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr