ID: 973804436

View in Genome Browser
Species Human (GRCh38)
Location 4:54512197-54512219
Sequence TTGGTGTTCAGGAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973804430_973804436 6 Left 973804430 4:54512168-54512190 CCCTGCTTAGCAACTCCTGAATA No data
Right 973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG No data
973804431_973804436 5 Left 973804431 4:54512169-54512191 CCTGCTTAGCAACTCCTGAATAA No data
Right 973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG No data
973804433_973804436 -9 Left 973804433 4:54512183-54512205 CCTGAATAATGAAATTGGTGTTC No data
Right 973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973804436 Original CRISPR TTGGTGTTCAGGAGGAAAAA AGG Intergenic
No off target data available for this crispr