ID: 973807177

View in Genome Browser
Species Human (GRCh38)
Location 4:54537846-54537868
Sequence CTGGGGCTGCCCCAGGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973807169_973807177 -1 Left 973807169 4:54537824-54537846 CCATCCAGCAGCTCTTACTTAGC No data
Right 973807177 4:54537846-54537868 CTGGGGCTGCCCCAGGGTGTGGG No data
973807168_973807177 0 Left 973807168 4:54537823-54537845 CCCATCCAGCAGCTCTTACTTAG No data
Right 973807177 4:54537846-54537868 CTGGGGCTGCCCCAGGGTGTGGG No data
973807167_973807177 1 Left 973807167 4:54537822-54537844 CCCCATCCAGCAGCTCTTACTTA No data
Right 973807177 4:54537846-54537868 CTGGGGCTGCCCCAGGGTGTGGG No data
973807165_973807177 6 Left 973807165 4:54537817-54537839 CCCATCCCCATCCAGCAGCTCTT No data
Right 973807177 4:54537846-54537868 CTGGGGCTGCCCCAGGGTGTGGG No data
973807171_973807177 -5 Left 973807171 4:54537828-54537850 CCAGCAGCTCTTACTTAGCTGGG No data
Right 973807177 4:54537846-54537868 CTGGGGCTGCCCCAGGGTGTGGG No data
973807164_973807177 7 Left 973807164 4:54537816-54537838 CCCCATCCCCATCCAGCAGCTCT No data
Right 973807177 4:54537846-54537868 CTGGGGCTGCCCCAGGGTGTGGG No data
973807163_973807177 21 Left 973807163 4:54537802-54537824 CCTTGAGGCAACTGCCCCATCCC No data
Right 973807177 4:54537846-54537868 CTGGGGCTGCCCCAGGGTGTGGG No data
973807166_973807177 5 Left 973807166 4:54537818-54537840 CCATCCCCATCCAGCAGCTCTTA No data
Right 973807177 4:54537846-54537868 CTGGGGCTGCCCCAGGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973807177 Original CRISPR CTGGGGCTGCCCCAGGGTGT GGG Intergenic