ID: 973808057

View in Genome Browser
Species Human (GRCh38)
Location 4:54544608-54544630
Sequence GTGCCCTCCATGAGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973808057_973808066 10 Left 973808057 4:54544608-54544630 CCACCCACCCTCATGGAGGGCAC No data
Right 973808066 4:54544641-54544663 CCTTCTTTCTCTTCCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973808057 Original CRISPR GTGCCCTCCATGAGGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr