ID: 973808066

View in Genome Browser
Species Human (GRCh38)
Location 4:54544641-54544663
Sequence CCTTCTTTCTCTTCCCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973808061_973808066 2 Left 973808061 4:54544616-54544638 CCTCATGGAGGGCACAGATCAGC No data
Right 973808066 4:54544641-54544663 CCTTCTTTCTCTTCCCACACTGG No data
973808059_973808066 6 Left 973808059 4:54544612-54544634 CCACCCTCATGGAGGGCACAGAT No data
Right 973808066 4:54544641-54544663 CCTTCTTTCTCTTCCCACACTGG No data
973808057_973808066 10 Left 973808057 4:54544608-54544630 CCACCCACCCTCATGGAGGGCAC No data
Right 973808066 4:54544641-54544663 CCTTCTTTCTCTTCCCACACTGG No data
973808060_973808066 3 Left 973808060 4:54544615-54544637 CCCTCATGGAGGGCACAGATCAG No data
Right 973808066 4:54544641-54544663 CCTTCTTTCTCTTCCCACACTGG No data
973808054_973808066 14 Left 973808054 4:54544604-54544626 CCGGCCACCCACCCTCATGGAGG No data
Right 973808066 4:54544641-54544663 CCTTCTTTCTCTTCCCACACTGG No data
973808058_973808066 7 Left 973808058 4:54544611-54544633 CCCACCCTCATGGAGGGCACAGA No data
Right 973808066 4:54544641-54544663 CCTTCTTTCTCTTCCCACACTGG No data
973808052_973808066 25 Left 973808052 4:54544593-54544615 CCTTGGAGTAGCCGGCCACCCAC No data
Right 973808066 4:54544641-54544663 CCTTCTTTCTCTTCCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973808066 Original CRISPR CCTTCTTTCTCTTCCCACAC TGG Intergenic
No off target data available for this crispr