ID: 973813874

View in Genome Browser
Species Human (GRCh38)
Location 4:54600250-54600272
Sequence ATATCCTTCTACAGGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973813869_973813874 18 Left 973813869 4:54600209-54600231 CCTATTTTATTCTAAACCATGGA No data
Right 973813874 4:54600250-54600272 ATATCCTTCTACAGGACTGAAGG No data
973813871_973813874 2 Left 973813871 4:54600225-54600247 CCATGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 973813874 4:54600250-54600272 ATATCCTTCTACAGGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973813874 Original CRISPR ATATCCTTCTACAGGACTGA AGG Intergenic
No off target data available for this crispr