ID: 973816412

View in Genome Browser
Species Human (GRCh38)
Location 4:54623418-54623440
Sequence CTGCTGGAACAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973816412_973816416 1 Left 973816412 4:54623418-54623440 CCTTCCTCACTCTGTTCCAGCAG No data
Right 973816416 4:54623442-54623464 ACTGGCTTCCTCGACATACTTGG No data
973816412_973816419 30 Left 973816412 4:54623418-54623440 CCTTCCTCACTCTGTTCCAGCAG No data
Right 973816419 4:54623471-54623493 CTAAGTTCATTCCAAGCTCAGGG No data
973816412_973816418 29 Left 973816412 4:54623418-54623440 CCTTCCTCACTCTGTTCCAGCAG No data
Right 973816418 4:54623470-54623492 TCTAAGTTCATTCCAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973816412 Original CRISPR CTGCTGGAACAGAGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr