ID: 973820382

View in Genome Browser
Species Human (GRCh38)
Location 4:54657741-54657763
Sequence CGCGCGCGCCCTCCTCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973820379_973820382 3 Left 973820379 4:54657715-54657737 CCGGAGTCAAGAGCGGGGAGAGA 0: 1
1: 0
2: 0
3: 12
4: 240
Right 973820382 4:54657741-54657763 CGCGCGCGCCCTCCTCCTCCCGG 0: 1
1: 0
2: 3
3: 31
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973820382 Original CRISPR CGCGCGCGCCCTCCTCCTCC CGG Intergenic
900148831 1:1169541-1169563 AGCCCTGGCCCTCCTCCTCCAGG + Intergenic
900593075 1:3468418-3468440 CCCGGGCTCCCTCCTCCTCGGGG - Intronic
900658565 1:3772170-3772192 CGCGGGGACCGTCCTCCTCCGGG - Intergenic
900833830 1:4984944-4984966 CGTACGCACTCTCCTCCTCCGGG - Intergenic
901084550 1:6602682-6602704 CGCGCCCGCCCGCCGCCTCCAGG + Exonic
901361319 1:8703264-8703286 CCCGCGCGGCCACCGCCTCCCGG - Intronic
902456218 1:16535678-16535700 TCCGCGCTCCCGCCTCCTCCTGG - Intergenic
902495944 1:16872233-16872255 TCCGCGCTCCCGCCTCCTCCTGG + Intronic
902501454 1:16914186-16914208 GGCGCGCGGCCTCCTCCGCCGGG - Intronic
902916713 1:19644172-19644194 CGCGCGCGGCCTCTCCCTCCGGG - Intronic
905384935 1:37596000-37596022 GGCGCGCGCCGTCACCCTCCTGG + Intergenic
905449562 1:38047578-38047600 CGCGCGGGCACACCTTCTCCCGG + Intergenic
907296889 1:53461163-53461185 CGAGCTCCTCCTCCTCCTCCGGG - Intronic
910200055 1:84690279-84690301 CGCGCGCGCCCGCCCCTTGCCGG + Intronic
910338330 1:86157156-86157178 CGGGCGCGCTCGCCTCCGCCTGG + Intergenic
914492383 1:148160484-148160506 CCCGCGCGCCCTCTCCCTACCGG - Intergenic
914702867 1:150150112-150150134 CCCTCGCGCCCTCCCGCTCCCGG - Exonic
919451306 1:197775495-197775517 CGCGCGCCCCTTCCCCCTCCCGG - Intronic
920184396 1:204151378-204151400 TGCACACGCCCCCCTCCTCCCGG - Intronic
920401717 1:205680366-205680388 AGCGCGCCCCCTCCTCTCCCAGG - Intronic
921384047 1:214551753-214551775 CCAGCGCTCCCTCCGCCTCCCGG - Intronic
923024777 1:230195773-230195795 CCAGCGCTCCCTCCTCCTCCAGG - Intronic
923400752 1:233614021-233614043 CCCGCCCGCCCCGCTCCTCCGGG - Exonic
923744381 1:236686736-236686758 CGCGGTCCCACTCCTCCTCCTGG - Exonic
1065099585 10:22320784-22320806 CCCGGCCGCCCGCCTCCTCCCGG - Intronic
1065390155 10:25174918-25174940 GGCGCGCGCCCCGCGCCTCCGGG + Intergenic
1067015228 10:42753316-42753338 CCAGCGCGGCCTCCTCCTCCAGG + Intergenic
1067560328 10:47300599-47300621 AGCGCTCGCCTTCCTCCTCCTGG + Exonic
1067769238 10:49111484-49111506 CACTCGCCCCCTCCTCCACCAGG + Intronic
1069659648 10:70115177-70115199 AGCTCGCCCTCTCCTCCTCCTGG - Intronic
1070314258 10:75295294-75295316 CAGTCCCGCCCTCCTCCTCCTGG + Intergenic
1070329996 10:75409704-75409726 CGCGCGGGCCCGCCCGCTCCAGG + Intergenic
1071332228 10:84571518-84571540 CGAGCGCCGCCCCCTCCTCCAGG + Intergenic
1074165741 10:110872275-110872297 GGCGCGGGCCCGCCCCCTCCCGG + Intronic
1074815221 10:117137485-117137507 GGAGCGCGCACACCTCCTCCCGG + Intronic
1075440499 10:122476166-122476188 AGAGCGCTTCCTCCTCCTCCAGG - Intronic
1075475113 10:122727671-122727693 CCCGCGGCCCCTCCTCCTCAAGG - Intergenic
1076858553 10:133129028-133129050 CGAAGGCGCCCTCCTCCTGCAGG - Exonic
1077044263 11:537543-537565 CCTGGGCGCCCTCCACCTCCAGG - Exonic
1077102571 11:828643-828665 CGAGTTCCCCCTCCTCCTCCTGG - Exonic
1077268890 11:1665945-1665967 CGGGCCCGCCCTCAGCCTCCAGG - Intergenic
1077271862 11:1685235-1685257 CGGGCCCGCCCTCAGCCTCCAGG + Intergenic
1077326774 11:1967385-1967407 CGGGCGCCCCCTCCTCCAGCAGG - Intronic
1078210236 11:9264829-9264851 CGCGCCCGCCCTGGTCCTCCCGG + Intronic
1081992163 11:47343658-47343680 CGCCCGCACCCTGCTCCCCCAGG + Intronic
1082243512 11:49893573-49893595 CGTGCTCCTCCTCCTCCTCCTGG + Intergenic
1083485591 11:62981344-62981366 CCCGCTGGCACTCCTCCTCCGGG - Exonic
1083599608 11:63938830-63938852 TCCGCGCTCCCGCCTCCTCCTGG + Intergenic
1084173189 11:67410309-67410331 CTGGGGCGCCCTCCTCCTGCAGG - Intronic
1084195967 11:67523726-67523748 CACGCCTGCCTTCCTCCTCCTGG - Intergenic
1084516328 11:69639597-69639619 CCCGCGCCCCCTCCCCCGCCGGG - Intergenic
1084616060 11:70236670-70236692 CACGCGCCCCCACCTCCTCCAGG + Intergenic
1085098387 11:73779509-73779531 GGCGCGCTCCCTCCTCCACATGG - Intergenic
1085392794 11:76191005-76191027 CGCACGCCCCCATCTCCTCCTGG - Intronic
1088172874 11:107017968-107017990 GGCACTCCCCCTCCTCCTCCGGG + Exonic
1089298251 11:117482245-117482267 CGCCCCAGCCCTCCTCCCCCAGG + Intronic
1090803702 11:130189790-130189812 CGCGCTCGGCCTCCTCCACCAGG - Exonic
1091259688 11:134224650-134224672 CGCCCGCCCCCTCCCCCGCCCGG + Exonic
1202809755 11_KI270721v1_random:22565-22587 CGGGCGCCCCCTCCTCCAGCAGG - Intergenic
1091916134 12:4272811-4272833 CACTCGCCCCCTCCCCCTCCCGG + Intergenic
1091985882 12:4910051-4910073 CTCGCCCGCCCGCCTCCTTCGGG + Exonic
1093435317 12:19129657-19129679 CGCGCGCGCCCTACCCCCTCGGG - Intergenic
1093435653 12:19130879-19130901 CTCGCACGCCCACCGCCTCCTGG - Intronic
1094219261 12:27975166-27975188 CCTGCGCGCCCCCCTCCTCCCGG + Intergenic
1095979524 12:47963550-47963572 AGCGCGCGCCCGCGTTCTCCTGG + Intronic
1096435928 12:51591146-51591168 CGCGCGCGCGCCCCTACTGCCGG - Intronic
1096460873 12:51820991-51821013 CGAGGGCGCGCGCCTCCTCCAGG - Intergenic
1096992638 12:55817730-55817752 CACCCGCGGCCTCCGCCTCCAGG + Exonic
1097264512 12:57737824-57737846 GGGGCGCCCCCACCTCCTCCCGG - Exonic
1101150362 12:101877700-101877722 CGCGCCCGGCCGCCGCCTCCAGG + Exonic
1102254132 12:111406291-111406313 TGCCCGCGCTCCCCTCCTCCGGG + Intronic
1103749782 12:123150870-123150892 CGCGCGCCCCCGCCGCCTGCTGG + Intergenic
1103899365 12:124295390-124295412 CGCGGGCCCCCCGCTCCTCCGGG - Intronic
1104008855 12:124914934-124914956 CGCGGGCGCCCCCCTCCTCACGG - Exonic
1104989717 12:132618792-132618814 CGCGGGCGGCCCCCACCTCCAGG - Intronic
1108227416 13:48303756-48303778 CGGACGCGCCCTCCCCCGCCCGG - Exonic
1113600158 13:111562927-111562949 CGCCTGCACCCTCCTCCCCCAGG - Intergenic
1113751933 13:112782678-112782700 AGGACGGGCCCTCCTCCTCCGGG - Intronic
1113874174 13:113584464-113584486 CGCGCGCGCACTGCCCGTCCCGG + Intergenic
1113946810 13:114048974-114048996 CGCCACCGCCCTCCCCCTCCAGG + Intronic
1114070192 14:19099416-19099438 CCAGCGCAGCCTCCTCCTCCAGG - Intergenic
1114092072 14:19300586-19300608 CCAGCGCAGCCTCCTCCTCCAGG + Intergenic
1119003932 14:70907633-70907655 CGCTCGCCGCCTCCTCCTCTCGG + Exonic
1119786976 14:77321139-77321161 TTCGCGCGACCCCCTCCTCCAGG - Exonic
1122221335 14:100240381-100240403 CGCGCGCCCCCGCCCCCGCCCGG + Intronic
1122542818 14:102507451-102507473 CGCGCGCCCGCTCCTCGGCCGGG + Exonic
1122665540 14:103327002-103327024 CGCGTGTGCTCTCCCCCTCCAGG - Intergenic
1123040996 14:105490196-105490218 CGCCCCCGACCTCCTCTTCCAGG - Intronic
1123584162 15:21742296-21742318 CGTCCGCGCCCTCCGCCTCCTGG + Intergenic
1123620812 15:22184899-22184921 CGTCCGCGCCCTCCGCCTCCTGG + Intergenic
1125503225 15:40252374-40252396 CCCGCCCGCCCTTCGCCTCCGGG - Exonic
1129752796 15:78077613-78077635 CGCCGCCGCCCTCCTCCGCCCGG + Exonic
1130224421 15:82046335-82046357 AGCCCGCCCCGTCCTCCTCCCGG + Intergenic
1130411772 15:83654002-83654024 GGCGCGCGCCCTCCGCCTCTGGG + Intergenic
1131096133 15:89655321-89655343 CGCGCGCTCCCTCCTCGCGCAGG - Intronic
1131160591 15:90102429-90102451 CGAGCGCGCGCCGCTCCTCCCGG + Exonic
1131367451 15:91853093-91853115 GGCGCGCGCTCTTCTCCGCCCGG - Intergenic
1131828630 15:96340711-96340733 CCCGCTCCCCCTCCTCCTCGTGG + Intergenic
1132781086 16:1626036-1626058 GGGGCTCGCGCTCCTCCTCCCGG + Exonic
1132991640 16:2798593-2798615 CCCTCGCGGCCTCCACCTCCCGG - Intergenic
1133259454 16:4538645-4538667 CGCGGGAGCCCTCCTCCCCGGGG - Intronic
1133340663 16:5033667-5033689 CGCGCGCGCGCGCCTCCCCCGGG - Exonic
1133994742 16:10739919-10739941 CTCAGGCCCCCTCCTCCTCCTGG - Intergenic
1137617616 16:49856671-49856693 CGCGCGCCCCTTCCTCCTCCGGG - Intronic
1138651600 16:58464149-58464171 CGCGCCCTTCCTCCGCCTCCTGG + Exonic
1139852671 16:69960407-69960429 CGCACGAGCACTCCTCCTCCCGG - Exonic
1139881642 16:70183315-70183337 CGCACGAGCACTCCTCCTCCCGG - Exonic
1140370866 16:74412190-74412212 CGCACGAGCACTCCTCCTCCCGG + Exonic
1141605633 16:85151903-85151925 CGCCCCCGCCCTCCTCTCCCCGG + Intergenic
1141633834 16:85303420-85303442 CGCGCATCCCCTCCTCCTGCAGG + Intergenic
1141830682 16:86508602-86508624 CGGGCGCGGCCTCTCCCTCCAGG - Intergenic
1142120254 16:88383432-88383454 CTCCCCCGACCTCCTCCTCCCGG + Intergenic
1142228776 16:88889707-88889729 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142228788 16:88889755-88889777 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142228796 16:88889786-88889808 CACGCGATTCCTCCTCCTCCAGG + Intronic
1142228807 16:88889834-88889856 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142228827 16:88889913-88889935 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142228835 16:88889944-88889966 CGTGCGATTCCTCCTCCTCCAGG + Intronic
1142228856 16:88890024-88890046 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142228869 16:88890073-88890095 CCCGCGATTCCTCCTCCTCCAGG + Intronic
1142903226 17:3026290-3026312 CGCGAGAGCCCTCCACCCCCAGG - Intronic
1143223742 17:5282640-5282662 CGCGCGCCCCCGCCTCCGCCCGG - Intronic
1144812087 17:18006976-18006998 CGCGCCGGGCCTGCTCCTCCCGG + Intronic
1146369720 17:32257978-32258000 CTCCCGCATCCTCCTCCTCCCGG - Intergenic
1146594504 17:34157179-34157201 CGCGCGCTGCCTCCTCTCCCCGG - Intronic
1147123971 17:38352809-38352831 CCCCCGCCCCCGCCTCCTCCCGG + Exonic
1147155673 17:38543508-38543530 CGCTCGCTCGCCCCTCCTCCAGG + Intronic
1147314692 17:39614036-39614058 GGCCCAGGCCCTCCTCCTCCGGG + Intergenic
1148538112 17:48457504-48457526 AGGGCGGCCCCTCCTCCTCCTGG + Intergenic
1148744493 17:49910730-49910752 CGCACGCGCACACTTCCTCCAGG + Intergenic
1148818300 17:50346251-50346273 CGCCCGCCTCGTCCTCCTCCAGG - Exonic
1148874361 17:50677958-50677980 CCCTCGCTCCCTGCTCCTCCAGG + Intronic
1151558678 17:74859818-74859840 CTCGCGCCCCCTCCTCCCGCGGG - Exonic
1151763328 17:76119751-76119773 CTCGCCCCTCCTCCTCCTCCTGG - Intronic
1151933467 17:77247459-77247481 AGCGACCTCCCTCCTCCTCCGGG + Intergenic
1152068925 17:78125717-78125739 CTCACTCACCCTCCTCCTCCAGG + Exonic
1152348605 17:79770225-79770247 CCTGCCCGCCCTTCTCCTCCAGG + Intergenic
1152809543 17:82375070-82375092 CGCGCGCGCCCCCGGCCGCCGGG - Exonic
1153829867 18:8912640-8912662 AGTCCACGCCCTCCTCCTCCTGG + Intergenic
1153872628 18:9334739-9334761 CCCGCCCGCCGCCCTCCTCCCGG - Intergenic
1154218591 18:12433332-12433354 AGCGCGCGGCTTCCGCCTCCTGG + Intergenic
1160030773 18:75257734-75257756 CGCGCCCTTCCTCCTCCTCATGG + Intronic
1160724827 19:613509-613531 CGCGTGCCCCCTCCCCCTCCAGG - Intronic
1160864046 19:1249462-1249484 CCCGCGCCCCCTCCCGCTCCCGG + Intronic
1161157393 19:2739761-2739783 AGCCCGTGCCCTCCTCATCCCGG - Intronic
1162932176 19:13962712-13962734 CGCGCGCGGCCTCTTCGTGCAGG - Exonic
1162954361 19:14090210-14090232 CGCGCGTGCGCTCCGGCTCCGGG + Exonic
1163248285 19:16110820-16110842 AGCGCGCGCCGGCCTCCTCAGGG - Intergenic
1163442462 19:17328782-17328804 CGCCCCCGCCCTCATCCGCCTGG + Exonic
1163666475 19:18606226-18606248 CGCGTGCGCCCGCCACGTCCTGG + Intronic
1165040453 19:33064659-33064681 AGTGCGCCCCCTCCCCCTCCCGG + Intronic
1165040899 19:33066688-33066710 CCCGCGGGCCATGCTCCTCCCGG + Intergenic
1165349491 19:35268429-35268451 CGCGCGCGCCCGCCCGCCCCCGG + Intergenic
1166147654 19:40848547-40848569 CGCGCGCGGGTTCCTCGTCCTGG + Intronic
1166151793 19:40880412-40880434 CGCGCGCGGGTTCCTCGTCCTGG + Intronic
1166304074 19:41927963-41927985 CCCCCGCGCCCGCCCCCTCCTGG + Intronic
1166888252 19:45973943-45973965 CGCCCGCGCCCGCCGCCCCCCGG - Intergenic
1167594249 19:50418869-50418891 AGCGGGCACCCTCCTCCCCCCGG + Intronic
1168152421 19:54456197-54456219 CCCGCTCCCGCTCCTCCTCCAGG + Exonic
1168237434 19:55072082-55072104 CTGGCCTGCCCTCCTCCTCCAGG + Intronic
1168242721 19:55095466-55095488 AGCGCTCGGCTTCCTCCTCCTGG - Exonic
1168316379 19:55486521-55486543 CGCCCTGGCCCTCCTCCTGCCGG + Exonic
1168333846 19:55585870-55585892 GGCCCCCGCCCCCCTCCTCCCGG - Intergenic
1202707108 1_KI270713v1_random:32034-32056 TCCGCGCTCCCGCCTCCTCCTGG - Intergenic
924985263 2:264477-264499 CCCGCGGCCCTTCCTCCTCCAGG + Intronic
925376229 2:3388117-3388139 AGCGCGCGCCCCCAGCCTCCGGG + Exonic
925411822 2:3643923-3643945 CGAAGGCGCCCTCCTTCTCCAGG - Exonic
926371757 2:12185845-12185867 CGGGCAAGCACTCCTCCTCCTGG + Intergenic
926901306 2:17754107-17754129 CGCGCGGCCCCGCCTCTTCCGGG - Intronic
927938229 2:27087127-27087149 CGCGTGGGAGCTCCTCCTCCAGG - Exonic
929548715 2:42875373-42875395 TGCCAGCTCCCTCCTCCTCCCGG + Intergenic
935046821 2:99490115-99490137 CGCACGCGCTCTGCTCCCCCCGG + Intergenic
935217829 2:100988730-100988752 CAGGCGCCCCCTGCTCCTCCAGG + Intronic
935217907 2:100988952-100988974 CAGGCGCCCCCTGCTCCTCCAGG + Intronic
936153910 2:110036116-110036138 AGCCTGGGCCCTCCTCCTCCGGG - Intergenic
936190775 2:110335299-110335321 AGCCTGGGCCCTCCTCCTCCGGG + Intergenic
937869586 2:126777552-126777574 CGCGCGCGCCCTCCAGTGCCCGG + Intergenic
937917773 2:127107268-127107290 CGCGCGCCCCTCCCTCCTCGCGG - Exonic
937951017 2:127388015-127388037 TGCGCGCGCACCCCTCCGCCCGG + Intronic
938397933 2:130964274-130964296 CGCACGCGCCCTCCGCGCCCGGG + Intronic
938736569 2:134191561-134191583 GGTTCGCGCCCTCCTCCTTCTGG + Intronic
940883427 2:158968921-158968943 GGAGCGCCCCCTCCTCCGCCGGG + Intronic
942116779 2:172735878-172735900 CGCGCGGACCCCGCTCCTCCCGG - Exonic
945431682 2:209772099-209772121 CGCGGCCGCCGTCCTGCTCCTGG - Exonic
946397721 2:219451659-219451681 CGAGGGCCGCCTCCTCCTCCGGG + Exonic
947593670 2:231398229-231398251 CGTGCGCACCCTCTTCCTGCTGG + Exonic
947602673 2:231464251-231464273 CGCGCAGGCCCTCCTCCCCGCGG + Intronic
948080639 2:235202684-235202706 CGCAGGCTCCCTCCTCCTCTCGG - Intergenic
948388248 2:237595007-237595029 AGCGCGCCCCCTCCTCCTTGGGG + Exonic
948453663 2:238093968-238093990 CCCACGCACCCTCCCCCTCCTGG - Intronic
948843810 2:240673242-240673264 AGGGCGCGCCCTTCTGCTCCAGG - Intergenic
948849953 2:240701062-240701084 AGGGCGCGCCCTTCTGCTCCAGG + Intergenic
948945852 2:241218394-241218416 CGCCCGCGGCCCCCTCCACCTGG - Intronic
949018174 2:241725282-241725304 CGCGCCCGCCCACGTCCGCCGGG - Exonic
949040115 2:241844143-241844165 CACGCGCCCCGGCCTCCTCCCGG + Intergenic
1169065666 20:2693123-2693145 CGCCCGCAGCCTCCGCCTCCCGG + Exonic
1169113218 20:3046289-3046311 CGCGGGCGGCCACCTCCCCCCGG - Intronic
1169143555 20:3238929-3238951 CACCCGCGCCCTCCTCCCCGCGG + Intronic
1171194770 20:23188094-23188116 CAGGTGCACCCTCCTCCTCCAGG + Intergenic
1172803995 20:37598323-37598345 CGCGCGCTCCCTCCCCCTGCAGG + Intergenic
1173909203 20:46651529-46651551 CGCCCTCTCCCTGCTCCTCCTGG + Intronic
1174386618 20:50191347-50191369 CCCCCGCGCCCGCCTCCTCCGGG + Exonic
1175466793 20:59194725-59194747 TGCGCCGGCCCTCCTTCTCCAGG - Exonic
1176139269 20:63537979-63538001 CCCTCGGGCCCTCCTCTTCCGGG - Intergenic
1176674718 21:9767717-9767739 AGCTTGCGCCCTCCCCCTCCCGG + Intergenic
1178992293 21:37366427-37366449 CGCGATCGCCCGCCGCCTCCCGG - Intronic
1179626776 21:42653568-42653590 GGCTCGCGCGCTCCTCCTCCCGG - Intergenic
1179796770 21:43789544-43789566 CTCCTGCGCCCGCCTCCTCCTGG - Exonic
1180014797 21:45074911-45074933 CGCGGGCGCCCTCCGCTCCCGGG - Intronic
1180059897 21:45379400-45379422 AGCGCACGCCCTCCCCATCCGGG + Intergenic
1180110331 21:45644298-45644320 GGCGCGGGGCCTCCTCCCCCTGG + Intronic
1180228867 21:46414447-46414469 GTCGCCCACCCTCCTCCTCCTGG + Intronic
1180228894 21:46414558-46414580 GCCGCCCACCCTCCTCCTCCTGG + Intronic
1180488662 22:15821978-15822000 CCAGCGCAGCCTCCTCCTCCAGG - Intergenic
1182122899 22:27798535-27798557 CTGGCGCCCCCTCCTCCGCCTGG - Exonic
1182715169 22:32352526-32352548 GGAGGGCGCCCTCCTCCTGCTGG - Intergenic
1183062799 22:35346208-35346230 GGCACCCGCCCTCCTCCTCCTGG - Intronic
1184265217 22:43342917-43342939 CGCGCTCGCGCTTCCCCTCCCGG + Intronic
1184362010 22:44024428-44024450 CTCGCGCGCCCTCCGCTTCCTGG - Intronic
1184580397 22:45413151-45413173 CGCTCTCGCCCTCCACCTCCTGG - Intronic
1184609265 22:45592152-45592174 CACGGTCGCCCTCCTTCTCCTGG - Intronic
1184766961 22:46577156-46577178 CCCGCGGGGCCGCCTCCTCCCGG + Intronic
1185315944 22:50179145-50179167 GGCCCCCGTCCTCCTCCTCCCGG - Exonic
1185395252 22:50583330-50583352 CTAGCGCGCGCGCCTCCTCCAGG - Intronic
950274061 3:11643335-11643357 AGCGCCCGCTGTCCTCCTCCGGG - Intronic
954375958 3:50194275-50194297 AGCGCGCGGTCTCCGCCTCCAGG - Intronic
956678321 3:71754847-71754869 CGCGCGCCGCCTCCTCGTGCTGG + Exonic
956681453 3:71785268-71785290 CACGCGCGCCCGCCTCGGCCCGG + Intergenic
957947988 3:87089098-87089120 CGCCCGCGCCCCCGTACTCCGGG - Intergenic
958108972 3:89114734-89114756 CGCGCGCTCCAGTCTCCTCCTGG - Intronic
964960799 3:162422826-162422848 CGCGCGCAAGCTCCACCTCCCGG + Intergenic
965757389 3:172040187-172040209 GCCGCCCGCCCTCCCCCTCCTGG - Intronic
966915767 3:184583487-184583509 CGCCCGCGGCCTCCTCCGCGCGG - Intronic
967166343 3:186783281-186783303 CCCGCCCGCCCTGCTCCTACGGG - Intronic
968585682 4:1414922-1414944 AGCGCCCGCCCCCCTCCTCTCGG + Intergenic
968605496 4:1533253-1533275 AGTGCGCGGCCTCCTCATCCTGG + Intergenic
968879834 4:3293175-3293197 CGCCCGCGCCCTCCGCCTCCCGG + Intronic
968883887 4:3317148-3317170 GCAGGGCGCCCTCCTCCTCCTGG - Exonic
973758923 4:54100012-54100034 CGCGCGCCCGCCCCTCCTCGCGG + Exonic
973820382 4:54657741-54657763 CGCGCGCGCCCTCCTCCTCCCGG + Intergenic
979439456 4:120734113-120734135 CGCCCGTGCCCCCTTCCTCCTGG - Intronic
979455528 4:120922457-120922479 CTCGCGCGCCCTGTGCCTCCCGG - Intronic
982584487 4:157220544-157220566 CGCGCGCCCCCTCCCCCGCACGG - Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
997912443 5:137889376-137889398 CGCGAGCCCCCAGCTCCTCCAGG - Intronic
999768076 5:154755720-154755742 CGGGCGCGCCCGGCTTCTCCGGG + Intronic
1000210917 5:159105299-159105321 CGCTCGCTCCTTTCTCCTCCCGG - Intergenic
1002521760 5:179796274-179796296 CGCGCGCGCCCTCTGGCTGCTGG + Exonic
1002527278 5:179821571-179821593 GGCGCTCGCCCGGCTCCTCCAGG - Intronic
1002548166 5:179966418-179966440 CGCTCGTGCTCTCCACCTCCGGG - Intronic
1002559475 5:180071776-180071798 CGCGCGCTCCCGCCGCCGCCCGG - Exonic
1002851927 6:1003995-1004017 CTCGCTCGCCCGCCTGCTCCCGG + Intergenic
1003218259 6:4135217-4135239 CGCGCACGCTCCCATCCTCCTGG - Intronic
1004272870 6:14211049-14211071 GGCGCGCCCACGCCTCCTCCCGG + Intergenic
1006502197 6:34466163-34466185 CGCCAGCCCCCTCCTCCCCCGGG + Exonic
1007829060 6:44624498-44624520 CGCCAGCCCCCTCCTCCTTCAGG - Intergenic
1010187283 6:73158109-73158131 CGCGCTCGCCCTCCCGCTACAGG + Intronic
1010980670 6:82365348-82365370 CGCCCGCGCGCACCTCGTCCAGG - Exonic
1014009754 6:116462106-116462128 GGCGCTCGCGCTCTTCCTCCTGG + Exonic
1015525927 6:134175401-134175423 CGCGCGCGACCTCGCCCGCCAGG + Intronic
1017164120 6:151391392-151391414 CGCGCACCGCCTCCGCCTCCCGG - Intronic
1019114815 6:169751594-169751616 CGCCTGCGCGCCCCTCCTCCAGG - Intergenic
1019777255 7:2919200-2919222 CCCCCAGGCCCTCCTCCTCCAGG - Intronic
1020066220 7:5190375-5190397 CGCGCGCGCCCTCCCCGGCCGGG + Exonic
1020099899 7:5388875-5388897 GCCGCGCGCCCTCGTCCTGCCGG + Exonic
1020116707 7:5480211-5480233 CCAGCCCGCCTTCCTCCTCCTGG - Intronic
1023882142 7:44326515-44326537 TGTGTGGGCCCTCCTCCTCCAGG - Intronic
1024485242 7:49910205-49910227 AGCGGGGGCCCTCCACCTCCTGG + Intronic
1025078670 7:55964475-55964497 GCCGCGCGCCCTGCTCCCCCTGG + Intronic
1025899407 7:65731842-65731864 AGCCTGCCCCCTCCTCCTCCGGG + Intergenic
1029746098 7:102516611-102516633 CCCTCCCACCCTCCTCCTCCAGG + Intronic
1029764036 7:102615590-102615612 CCCTCCCACCCTCCTCCTCCAGG + Intronic
1031986350 7:128166939-128166961 CGCGCCCCCGCACCTCCTCCAGG - Intergenic
1032344358 7:131105944-131105966 CGCGCGCGCCCGCCGCCGCCCGG - Intergenic
1033220473 7:139523886-139523908 CGCGCCCGCGCTCCTGCACCGGG - Exonic
1033899335 7:146116414-146116436 CGAGCGCTCCCTCCGCCGCCGGG - Exonic
1034417976 7:150975141-150975163 GGCGCGCCCCCTCCTCCGCCTGG + Intronic
1037819901 8:22130566-22130588 CGCTCGCGCTCTCCTTCCCCCGG + Exonic
1043029957 8:75121686-75121708 CACTCGAACCCTCCTCCTCCCGG - Intergenic
1043873771 8:85463609-85463631 CGCGCACCCCATCCCCCTCCCGG - Intergenic
1049218213 8:141417437-141417459 CTCGGGCGCCCTCCTCCTCAGGG + Intronic
1049405994 8:142452085-142452107 CGCGCGCAACGTCCGCCTCCGGG - Intronic
1049438411 8:142598225-142598247 AGCCCCCGCCCTCCTCCTCTGGG + Intergenic
1049651494 8:143771821-143771843 GCCGCGCGGCCTCCTGCTCCCGG - Intergenic
1049772941 8:144392159-144392181 CCCGCGCTCACTTCTCCTCCAGG - Exonic
1049801234 8:144518280-144518302 CGAGCGGGGCCTGCTCCTCCAGG - Intronic
1049801258 8:144518347-144518369 CGCCCCCGCCCGGCTCCTCCGGG - Intronic
1049843202 8:144787245-144787267 CCCGCGCGCCCGCCCCCGCCGGG + Intronic
1053313395 9:37033889-37033911 GGCGCGCCCCCTCCTCCTCCAGG + Intronic
1053399108 9:37801426-37801448 GGCGGGCGCCCGCCTCCGCCCGG + Intronic
1058176094 9:101738001-101738023 AGCGCGCCCCCTCCTGCGCCCGG + Exonic
1059176767 9:112175255-112175277 GGCGCGCCCGCGCCTCCTCCCGG + Exonic
1059375296 9:113876334-113876356 CCGGCGCGTCCTGCTCCTCCCGG - Exonic
1060629444 9:125143115-125143137 CGCGCCCGCCTTGCCCCTCCCGG + Intronic
1061403167 9:130379304-130379326 CGCCCCGGGCCTCCTCCTCCCGG - Intronic
1061853305 9:133428640-133428662 CGGGCGCGCCGTCGTGCTCCAGG - Exonic
1061920561 9:133780178-133780200 CACGGGCCCCCACCTCCTCCAGG + Intronic
1062620326 9:137417639-137417661 CGCGCGCCTCCTCCTCCGCTCGG - Intronic
1062653588 9:137590615-137590637 CGCACTCGCCCTCCTCCTATTGG - Intergenic
1062718649 9:138023512-138023534 CCCGCTCGGCCGCCTCCTCCGGG - Exonic
1187225849 X:17375146-17375168 CCCGCGCGGCCTCCTGCGCCCGG + Intergenic
1188919882 X:35959730-35959752 CGTGCGCAACCTCCGCCTCCTGG - Intronic
1189309334 X:40008936-40008958 CCCGGGCGGCCTCCTCTTCCCGG + Intergenic