ID: 973822609

View in Genome Browser
Species Human (GRCh38)
Location 4:54676238-54676260
Sequence AACTCAGCAGGTTCTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973822609_973822620 27 Left 973822609 4:54676238-54676260 CCCACCCAAGAACCTGCTGAGTT 0: 1
1: 0
2: 1
3: 14
4: 189
Right 973822620 4:54676288-54676310 TCTGTTTTAACAAGCTCTCCAGG 0: 4
1: 43
2: 208
3: 636
4: 1336
973822609_973822616 -4 Left 973822609 4:54676238-54676260 CCCACCCAAGAACCTGCTGAGTT 0: 1
1: 0
2: 1
3: 14
4: 189
Right 973822616 4:54676257-54676279 AGTTGGAAACTCTGAGAGCAGGG 0: 1
1: 0
2: 2
3: 35
4: 339
973822609_973822615 -5 Left 973822609 4:54676238-54676260 CCCACCCAAGAACCTGCTGAGTT 0: 1
1: 0
2: 1
3: 14
4: 189
Right 973822615 4:54676256-54676278 GAGTTGGAAACTCTGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973822609 Original CRISPR AACTCAGCAGGTTCTTGGGT GGG (reversed) Intronic
902230275 1:15023208-15023230 TTCTCAGCAGGTTATGGGGTAGG + Intronic
905303572 1:37002331-37002353 GACTCAGCTGGTTGTTGGGTTGG - Intronic
906163377 1:43667892-43667914 AACTCAGCTGCTTCTGGCGTGGG - Exonic
906211900 1:44016787-44016809 TTCTCAGCAGGTCCTTGGGCTGG + Intronic
906416217 1:45622821-45622843 AGCTCAGCGGGTTCCTGGGGTGG + Exonic
908317370 1:62946337-62946359 AACACAGCATGTTTTTGGCTGGG - Intergenic
911129896 1:94377148-94377170 ACCGTTGCAGGTTCTTGGGTGGG - Intergenic
917279766 1:173369522-173369544 ACCGTTGCAGGTTCTTGGGTGGG + Intergenic
918419630 1:184351456-184351478 TATTCAGCATGTTCTTTGGTAGG + Intergenic
919281614 1:195496385-195496407 AGCTCAGAATCTTCTTGGGTGGG + Intergenic
919788484 1:201275297-201275319 CACTCAGCAGGTTCCTGGCCTGG + Intergenic
921181388 1:212634403-212634425 AACACAGCAGGAATTTGGGTAGG + Intergenic
923648226 1:235845835-235845857 AGCTCAGCAGCTCCTTGGTTGGG - Intronic
924882462 1:248176646-248176668 AACTCAGAATGTTCTTTGTTTGG + Intergenic
924883280 1:248186869-248186891 AGCTCAGCCTTTTCTTGGGTGGG + Intergenic
1066614693 10:37282960-37282982 ACCACTGCAGGTTCTTGGGCAGG - Intronic
1071780830 10:88842653-88842675 AACTCTGCAGATGCTTGGGAAGG - Intronic
1072132315 10:92507282-92507304 AAATCAGCAGTTTCTTGAGCTGG - Intronic
1073970629 10:109042863-109042885 ACCGCTGCAGGTTCTTGGGCAGG + Intergenic
1074612912 10:115038711-115038733 ACCTTTGCGGGTTCTTGGGTCGG + Intergenic
1076183926 10:128431869-128431891 AGCTCAGCAGGCTCTCAGGTGGG + Intergenic
1077600268 11:3569744-3569766 AACACAGCAGGTACTAGGGGTGG + Intergenic
1078623369 11:12930426-12930448 AACTGACCAGGTTGTTGGATTGG + Intronic
1082089874 11:48080600-48080622 AAGTCAGAAGGGTGTTGGGTTGG + Intronic
1084256179 11:67944358-67944380 AACACAGCAGGTACTAGGGGTGG + Intergenic
1084816582 11:71650941-71650963 AACACAGCAGGTACTAGGGGTGG - Intergenic
1086434320 11:86766223-86766245 CACTCAGTGGGTTCTGGGGTTGG - Intergenic
1087193426 11:95280631-95280653 CACTCAGCAGATTCTGGGCTTGG + Intergenic
1087286249 11:96267921-96267943 AACTCAGCAGTTTCTTTTATAGG + Intronic
1088510268 11:110566404-110566426 AAATCACCAGCTTCTTGCGTGGG + Intergenic
1089151339 11:116366733-116366755 AAGTCAGGAGGGTCTTGAGTTGG - Intergenic
1089182723 11:116594186-116594208 CTCTCAGAAGGTTCTTGAGTTGG - Intergenic
1089409330 11:118226175-118226197 ACCTCTGCAGGTTCTTGCGGGGG + Intergenic
1089596502 11:119584348-119584370 AACTCAGCAGGAGGTTGGGCCGG - Intergenic
1091624869 12:2114111-2114133 AATTCAGGAAGTTCTTGTGTGGG + Intronic
1095950049 12:47776849-47776871 GACTCAGCAGTTTCTGGGTTAGG - Intronic
1097289639 12:57903790-57903812 TGCTCAGCAGTCTCTTGGGTTGG - Intergenic
1097877961 12:64661208-64661230 TACATAGCAGGTTCTTGGGCTGG + Intronic
1098072096 12:66686907-66686929 AACTCAGCAGGCTCATGTGATGG + Intronic
1098121149 12:67240363-67240385 AACTCAGCAGATTCTCAAGTAGG + Intergenic
1100861005 12:98807008-98807030 CACTGAGCAGATTCTTGGGGCGG - Intronic
1105620959 13:22065520-22065542 AAATGAGCAGGATCTTGGGTGGG + Intergenic
1106091855 13:26603200-26603222 AGCTCAGCAGCTTCTTGTGTCGG + Intronic
1113872481 13:113568055-113568077 GTCTCATCATGTTCTTGGGTAGG - Intergenic
1117703236 14:58436459-58436481 GACTCAACATGTTCTTGGATGGG + Intronic
1117783782 14:59261240-59261262 AACTGAGCAGGATCTGGGGGTGG - Intronic
1118017305 14:61673122-61673144 CACTCGGCAGGCTCCTGGGTGGG - Intergenic
1120208989 14:81615721-81615743 CACTGAGCCAGTTCTTGGGTGGG + Intergenic
1120755549 14:88240913-88240935 ATCACTGCAGGTTCTTGAGTAGG - Intronic
1120877210 14:89386056-89386078 AACTCAGCAAGTTTATGGGTAGG + Intronic
1121622164 14:95357850-95357872 GACTCAGCCAGTTCTTGCGTAGG + Intergenic
1122019625 14:98826896-98826918 CACACAGCAGGTCCTTGGGGAGG - Intergenic
1129231318 15:74198734-74198756 AGCTCAGCAGGTGCTGGGTTTGG - Intronic
1129778378 15:78252235-78252257 CACTCAGCAGGTGCGTGGGTGGG - Intergenic
1130907623 15:88251648-88251670 AACTCAGCTGGCTCTTGGGTGGG - Intronic
1133231754 16:4370270-4370292 AACTCAGATGGTTCTGGGGCCGG + Intronic
1133371886 16:5251476-5251498 AACACAGCAGGTACTAGGGGTGG - Intergenic
1134877914 16:17718570-17718592 TCCCCAGCAGGTTCTGGGGTGGG + Intergenic
1135135421 16:19883493-19883515 AATTCAGAAGTTTCTTCGGTGGG - Intronic
1137007875 16:35295419-35295441 AAATCAGCCTGTTCTTGGGAGGG - Intergenic
1137014569 16:35362278-35362300 AAATCAGCCTGTTCTTGGGAGGG - Intergenic
1137368170 16:47878841-47878863 AACACAGCATGTTCATGAGTAGG - Intergenic
1137645849 16:50073324-50073346 AACTCAGCAGAATTCTGGGTGGG + Intronic
1144608447 17:16688332-16688354 AGCTCAGCAGTGTCCTGGGTAGG - Intergenic
1145128211 17:20319265-20319287 AGCTCAGCAGTGTCCTGGGTAGG - Intergenic
1145196395 17:20897942-20897964 AGCTCAGCAGTGTCCTGGGTAGG + Intergenic
1146910729 17:36646824-36646846 AAAAAAGCAGGTTCTGGGGTCGG - Intergenic
1149850297 17:60030022-60030044 ACCTCAGCAGGCTCTTGTTTCGG - Intergenic
1149859869 17:60116502-60116524 ACCTCAGCAGGCTCTTGTTTCGG + Intergenic
1151705366 17:75764498-75764520 CACACAGCAGGTTCTTGGCGGGG - Intronic
1152465813 17:80465674-80465696 AACTCTGCACTTTCTTGAGTGGG + Intergenic
1153859119 18:9181997-9182019 AACCTAACAGGTTCTTGGTTGGG + Intronic
1155514910 18:26614995-26615017 AACTCAGCACTTTCTTAGGAAGG + Intronic
1155713514 18:28911519-28911541 AACTAAGCAGCTGCTTGGGTTGG - Intergenic
1160792104 19:927670-927692 CCCTCAGCACTTTCTTGGGTTGG + Intronic
1163697142 19:18769652-18769674 AACACAGCAGGTCCTGGGGGAGG + Intronic
1163870498 19:19817204-19817226 AAATCAGCATGTTCTTAGGAGGG - Intronic
1163879304 19:19903321-19903343 AAATCAGCATGTTCTTAGGAGGG + Intronic
1163898422 19:20079653-20079675 AAATCAGCATGTTCTTAGGAGGG + Intronic
1163913442 19:20216869-20216891 AAATCAGCATGTTCTTAGGAGGG - Intergenic
1163933630 19:20422402-20422424 AAATCAGCATGTTCTTAGGAGGG - Intergenic
1163948509 19:20562865-20562887 AAATCAGCATGTTCTTAGGAGGG - Intronic
1163959027 19:20669892-20669914 AAATCAGCATGTTCTTAGGAGGG + Intronic
1163993885 19:21024863-21024885 AAGTCAGCATGTTCTTAGGAGGG + Intronic
1164027302 19:21364391-21364413 AAGTCAGCATGTTCTTAGGAGGG + Intronic
1164048624 19:21564635-21564657 AAGTCAGCATGTTCTTAGGAGGG - Intergenic
1164070495 19:21763702-21763724 AAGTCAGCATGTTCTTAGGAGGG - Intronic
1164136232 19:22419018-22419040 AACTCAGCATGTCCTTAGGAAGG - Intronic
1165930193 19:39352736-39352758 TAGTCAGCAGCTTATTGGGTGGG + Intronic
1167230006 19:48276631-48276653 TACTCAGGAGGTTGTGGGGTGGG - Intronic
1168003014 19:53463967-53463989 AACTAAGCAAGGTCCTGGGTTGG + Intergenic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
927506377 2:23617603-23617625 AATTCAGCAGCTTCCTTGGTTGG + Intronic
927594254 2:24382981-24383003 AATTCAGAAGGTTGTGGGGTGGG - Intergenic
936449850 2:112625892-112625914 ATCTCAGCAGGAACCTGGGTTGG + Intergenic
938737214 2:134197152-134197174 AACTCTGCAGATTGGTGGGTTGG + Intronic
942440304 2:176028127-176028149 AACTAAGCAAGTACTTTGGTGGG + Intergenic
943470255 2:188286579-188286601 AGCTCTGCAGGTGCTTGGCTAGG + Intergenic
946537133 2:220643304-220643326 AAATCAACAGAATCTTGGGTTGG + Intergenic
946777589 2:223159521-223159543 ACCTCAACAGGTTATTGTGTAGG + Intronic
949064998 2:241984772-241984794 AACTGAGCATGTTCTGGGGTCGG - Intergenic
1169849791 20:10036185-10036207 AATTCAGTAGGTCCATGGGTCGG - Intronic
1170808793 20:19657330-19657352 AGTTCAACAGGCTCTTGGGTAGG + Intronic
1171062395 20:21978466-21978488 AACTGTGCAGGTTGCTGGGTAGG - Intergenic
1173579490 20:44137195-44137217 AAGTCAGCAGGCTCCTGGGCAGG - Intronic
1174842072 20:53910343-53910365 AAATCATGAGGTGCTTGGGTTGG + Intergenic
1175951092 20:62583746-62583768 AGCTCAGCAGGTTTTGAGGTAGG - Intergenic
1176334641 21:5584605-5584627 AACTCAGCCTGTTCTTAGGAGGG - Intergenic
1176393116 21:6236343-6236365 AACTCAGCCTGTTCTTAGGAGGG + Intergenic
1176468303 21:7079831-7079853 AACTCAGCCTGTTCTTAGGAGGG - Intronic
1176491864 21:7461609-7461631 AACTCAGCCTGTTCTTAGGAGGG - Intergenic
1176508778 21:7676774-7676796 AACTCAGCCTGTTCTTAGGAGGG + Intergenic
1178175285 21:30089964-30089986 ATCTCAGCATTTTCGTGGGTGGG - Intergenic
1178665301 21:34541396-34541418 CACTGAGCAGATTCTTGTGTAGG - Intronic
1181033527 22:20159279-20159301 AACCCAGCAGCTCCTTGGGTGGG + Intergenic
1181509781 22:23383965-23383987 AACCCAGCAGCTCCTTGGGTGGG - Intergenic
1182290339 22:29272858-29272880 AGCTCAGCAGCTCCTTGGCTAGG - Intronic
1183134189 22:35871068-35871090 TACTCAGCAGTATCCTGGGTTGG + Intronic
1183743351 22:39680091-39680113 CACACAGTAGGTGCTTGGGTAGG + Intronic
950221790 3:11201750-11201772 AACTCAGCAGGCACTTGGCAAGG - Intronic
952988878 3:38813564-38813586 AACTCAGCTGGACCTTGGTTAGG - Intergenic
956558370 3:70545911-70545933 AACTCACCAGCTTCTTTGGTTGG + Intergenic
956964211 3:74439971-74439993 ACCTCAGGGGGTTCCTGGGTAGG - Intronic
957071096 3:75568395-75568417 AACACAGCAGGTACTAGGGGTGG + Intergenic
960018955 3:112927312-112927334 AACTCAGCAGTTTCTGGCCTTGG - Intronic
960063561 3:113348179-113348201 ACCATTGCAGGTTCTTGGGTCGG + Intronic
968407375 4:352471-352493 AAGTCAGCCTGTTCTTGGGAGGG + Intronic
968414355 4:417345-417367 AAGTCAGCCTGTTCTTGGGAGGG + Intergenic
969014696 4:4096092-4096114 AACACAGCAGGTACTAGGGGTGG + Intergenic
969646396 4:8431993-8432015 AAGTCACCAGGTCCTTGGGAAGG + Intronic
969739245 4:9012348-9012370 AACACAGCAGGTACTAGGGGTGG - Intergenic
969798429 4:9543861-9543883 AACACAGCAGGTACTAGGGGTGG - Intergenic
970441879 4:16086925-16086947 TACTAAGCAGGCTCTTGGGGTGG + Intergenic
972996711 4:44888330-44888352 AACTCTACAGGTTATTGGGCTGG - Intergenic
973822609 4:54676238-54676260 AACTCAGCAGGTTCTTGGGTGGG - Intronic
980829390 4:138111569-138111591 CACTGAGTAGGTTCTTGGGTGGG + Intergenic
983503994 4:168532457-168532479 AACTCAGCTTCTTCTTGGATTGG - Intronic
983545578 4:168959975-168959997 AATTTACCATGTTCTTGGGTTGG - Intronic
983835070 4:172375589-172375611 ACCATTGCAGGTTCTTGGGTAGG - Intronic
985561899 5:592214-592236 AACTCAGCCTCTCCTTGGGTGGG + Intergenic
986994121 5:13586726-13586748 TAGTTAGCAGGTTCTTGTGTGGG - Intergenic
987577727 5:19752525-19752547 AACTCAGACTTTTCTTGGGTGGG - Intronic
988238865 5:28581841-28581863 GAGTCTGCAGGTTATTGGGTTGG - Intergenic
989496115 5:42112977-42112999 ACCATTGCAGGTTCTTGGGTGGG + Intergenic
989515259 5:42336335-42336357 ATCTCAGCAGGTTGTTTTGTGGG + Intergenic
991252428 5:64578461-64578483 AATTCAGTAGGTCCTTGGATAGG - Intronic
994231871 5:97316597-97316619 ACCACTGCAGGTTCTTGGGCAGG - Intergenic
994284219 5:97944411-97944433 AACTCAAGAGGTTCTTGAATAGG - Intergenic
997499317 5:134359316-134359338 AGCTCAGCAGGTTTTTTGTTTGG - Intronic
999503598 5:152171583-152171605 GACTCAGCAGTTTCTTTGCTCGG - Intergenic
1000696202 5:164387320-164387342 AAATCCTCAGGTCCTTGGGTTGG - Intergenic
1000763733 5:165258612-165258634 AACTCAGCAGGGATTTGGCTAGG + Intergenic
1000905236 5:166958192-166958214 AATTCAGCAAGTTCTTGGCTTGG + Intergenic
1001901890 5:175438294-175438316 AAATATGCAGGTTCTTGGGAGGG - Intergenic
1002610405 5:180414040-180414062 AACTCAGGAAGTTTTGGGGTTGG + Intergenic
1003914244 6:10770930-10770952 AACTAAGCAGGTTCACGGGGTGG + Intronic
1007259338 6:40552154-40552176 AATTCAGCAGGTTTTGGAGTGGG - Intronic
1007750672 6:44068819-44068841 AAGGCAGCAAGTTCTTAGGTTGG + Intergenic
1008475019 6:51927255-51927277 TACATAGCAGGTTGTTGGGTGGG + Intronic
1009869490 6:69435623-69435645 AACTCAGCCTGTTCTTCGGAAGG + Intergenic
1010074811 6:71787222-71787244 ACCATTGCAGGTTCTTGGGTGGG + Intergenic
1010863032 6:80937414-80937436 AACTCAGACTCTTCTTGGGTGGG + Intergenic
1013651363 6:112198310-112198332 GACCTAGCAGGTTCTTGGTTTGG + Intronic
1017339224 6:153301419-153301441 AATTTGGCAGGTTCTTGAGTAGG + Intergenic
1018817240 6:167342871-167342893 CTCCCAGCAGGTTCCTGGGTGGG + Intronic
1020213143 7:6170280-6170302 AACTCAGCAGTTTTCTGGGACGG + Intronic
1023564906 7:41514576-41514598 AACACAGTGGGTTCTGGGGTGGG + Intergenic
1024169360 7:46768298-46768320 AACTAAGCAGCCTCTTGGGCTGG - Intergenic
1025224288 7:57143240-57143262 AAGTCAGCCTGTTCTTGGGAGGG + Intergenic
1025745368 7:64238205-64238227 AAGTCAGCCTGTTCTTGGGAGGG - Intronic
1025778875 7:64581978-64582000 AAGTCAGCATGTTCTTAGGAAGG + Intergenic
1025815468 7:64907005-64907027 AAGTCAGCATGTTCTTAGCTGGG + Intronic
1029073368 7:97917722-97917744 AACACAGCAGGTACTAGGGGTGG + Intergenic
1029980555 7:104874824-104874846 AACTCAGCAGTTTGATGGTTTGG + Intronic
1034095316 7:148402406-148402428 AAGTCAGCAGGTTTTTCCGTAGG - Intronic
1034141305 7:148820189-148820211 CTCTCACCAGGTTCTTGGATTGG - Intronic
1035348564 7:158226409-158226431 AACACACCAGGTTTGTGGGTGGG + Intronic
1035931830 8:3788424-3788446 ATCTCAGCTGGTTCTTCTGTTGG - Intronic
1036256423 8:7210171-7210193 AACACAGCAGGTACTAGGGGTGG + Intergenic
1036308473 8:7668756-7668778 AACACAGCAGGTACTAGGGGTGG + Intergenic
1036361061 8:8077321-8077343 AACACAGCAGGTACTAGGGGTGG - Intergenic
1036889902 8:12589680-12589702 AACACAGCAGGTACTAGGGGTGG + Intergenic
1036897509 8:12647841-12647863 AACACAGCAGGTACTAGGGGTGG + Intergenic
1042771767 8:72389621-72389643 AACATTGCAGGTTCTTGGGCAGG + Intergenic
1043706652 8:83358687-83358709 AACTAGGCAGGTGCTTGGGCTGG + Intergenic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1048208141 8:132431853-132431875 AGTTCAGCAGGTGCCTGGGTGGG - Intronic
1049487762 8:142875381-142875403 ACCTCTGCGGGTTCTTCGGTAGG - Intronic
1049624799 8:143615171-143615193 ACCTCAGCAGCCTCCTGGGTGGG - Intronic
1052361085 9:27559032-27559054 AAATAAGCAGGTCATTGGGTGGG + Intronic
1059137097 9:111817511-111817533 CACTGAGCCGGTTCCTGGGTAGG + Intergenic
1059458523 9:114414879-114414901 CACTCAGCAGCTTCCTGGGGTGG + Intronic
1059920733 9:119157427-119157449 GACTCACCAAGTTCTTGGCTTGG + Intronic
1060182497 9:121544271-121544293 AACTCAGCAGGATATTGGTTTGG + Intergenic
1060508284 9:124214656-124214678 AAATGAGCAGGTCCCTGGGTGGG + Intergenic
1062699758 9:137892726-137892748 AAGACAGCAGGTGCTGGGGTGGG - Intronic
1203426994 Un_GL000195v1:50315-50337 AACTCAGCCTGTTCTTAGGAGGG + Intergenic
1190693588 X:52932852-52932874 AGCCCAACAGGTTCTTGGCTTGG - Intronic
1193429052 X:81377795-81377817 ATCTCAGCAGGTTCTAGCATAGG - Intergenic
1197034650 X:121859322-121859344 AACTCAGCCTCTTCTTGGGTGGG + Intergenic
1198625161 X:138563997-138564019 AAATCAGCAGGTTCATAGGATGG + Intergenic
1198687943 X:139247758-139247780 AGATGAGCAGGTTTTTGGGTGGG - Intergenic
1199832566 X:151560547-151560569 AACGTTGCAGGTTCTTGGGCAGG - Intergenic
1200036717 X:153335666-153335688 ATTTCAGCAGGTTCCTGGGCAGG + Intronic
1200142235 X:153908014-153908036 AACTCAGGTGGGTCTTGGGCAGG - Intronic