ID: 973822651

View in Genome Browser
Species Human (GRCh38)
Location 4:54676583-54676605
Sequence CTGCATGGGTGGAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 1, 2: 5, 3: 56, 4: 659}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973822642_973822651 13 Left 973822642 4:54676547-54676569 CCATGGGACAGTGCTGCAGTAGA 0: 1
1: 1
2: 4
3: 22
4: 192
Right 973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG 0: 1
1: 1
2: 5
3: 56
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973822651 Original CRISPR CTGCATGGGTGGAGGGAGCA GGG Intronic
900188881 1:1345099-1345121 CTGGATGGTGGGAGGGGGCAGGG - Intronic
900360109 1:2284259-2284281 CAGCATGGGTCCAGGGATCAGGG - Intronic
900391986 1:2437572-2437594 CTGAAGGGGTGGAGGCTGCAGGG - Intronic
900407782 1:2500022-2500044 CTGTAGGGGTGGAGGCTGCAAGG - Intronic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
900484159 1:2913640-2913662 CTCCAGGGGTGGTGGGAGGAAGG - Intergenic
900500804 1:3003639-3003661 CTGCAGCTGTGGAGGCAGCACGG - Intergenic
900520872 1:3104962-3104984 GTGCATGGGAGGAGGCAGGATGG + Intronic
900607628 1:3530958-3530980 CTGCTAGGCTGGAGGGAGCAGGG - Intronic
900618599 1:3576787-3576809 CTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618624 1:3576887-3576909 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618632 1:3576916-3576938 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618647 1:3576987-3577009 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900618655 1:3577016-3577038 GTGCAGGGGTGGAGTGTGCAGGG - Intronic
900633260 1:3649833-3649855 CCGCGTGGGTGGAGGCAGCTTGG - Intronic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
901128950 1:6950159-6950181 CTGGCTGGGCGGAGGCAGCAAGG + Intronic
901199605 1:7459141-7459163 CTGCTGGGGAGGAAGGAGCAAGG + Intronic
901201948 1:7472112-7472134 TTGCTTGGGTGGAGGCAGCGGGG + Intronic
901683016 1:10926476-10926498 CAGGATTGGTGGAGGCAGCAAGG - Intergenic
901928582 1:12582891-12582913 ATGCATGGATGGATGGAGTAGGG - Intronic
902255422 1:15186070-15186092 CTGAGTGGGAGGAGGGGGCAGGG - Intronic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
904607226 1:31704398-31704420 GGACAGGGGTGGAGGGAGCAGGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904947040 1:34206906-34206928 CTGCATGGGAGCAGAGAGCAAGG + Intronic
905170648 1:36107814-36107836 CGGCATGTGTGCAGGAAGCAGGG - Intronic
905497481 1:38403950-38403972 CTGCTTTTGTGGAGGTAGCAGGG - Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
907011653 1:50968922-50968944 CTGTAGGGGTGAAAGGAGCAGGG + Exonic
907220639 1:52904834-52904856 CTACCAGGATGGAGGGAGCAGGG + Intronic
907299404 1:53477219-53477241 CTCCAAGGGTGAGGGGAGCATGG - Intergenic
907611117 1:55872170-55872192 CTCCATGTGTGGAGGGAGGGAGG - Intergenic
907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG + Intergenic
909235918 1:73152633-73152655 CTGCAGGGGTGGAGGCCTCATGG - Intergenic
909618215 1:77636673-77636695 CAGCCTGGGTGATGGGAGCAAGG + Intronic
909660731 1:78078950-78078972 GTGAATGGGTTGAGGGAGAAGGG - Intronic
909941589 1:81617337-81617359 ATGGATGGGTGGAGGTAGGAAGG - Intronic
909984214 1:82140698-82140720 CTGCTAAGGTGGAAGGAGCAGGG + Intergenic
910069450 1:83194148-83194170 CTTCATGGTGGGAGGAAGCATGG - Intergenic
910510807 1:88001910-88001932 CGGCAGGGGTGGAAGGGGCAGGG + Intergenic
910708463 1:90154718-90154740 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
911323287 1:96440233-96440255 CTGCTCCGGTGGAGGCAGCAGGG + Intergenic
911376392 1:97056841-97056863 CTGCATGGGTGGAGCCCTCAAGG + Intergenic
912448142 1:109752764-109752786 CAGCATGGTGGGAGGGAGCTGGG + Intronic
912612392 1:111061765-111061787 CTGCTTCAGTGGAGGAAGCAGGG + Intergenic
912654365 1:111472376-111472398 TTGGATGGATGGAGGGAGAAAGG - Intergenic
912667214 1:111593072-111593094 CTGAGTGGGTGGAGGGGGCGGGG + Intronic
913074221 1:115327812-115327834 CTGCTTGGGAGGTGGGGGCAGGG + Intronic
913094488 1:115503424-115503446 CTGCATGGGTGGAGCCCTCATGG + Intergenic
913383468 1:118233939-118233961 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
914844797 1:151276779-151276801 GGGCATGGGTCGAGGGAGCTGGG - Intergenic
914992307 1:152509626-152509648 TTGCACAGGTGGAGAGAGCAAGG + Intergenic
915456179 1:156042237-156042259 CTGCCAGGGTGAAGGTAGCAGGG + Intronic
916850046 1:168694597-168694619 CTGGGAGGGTGCAGGGAGCATGG - Intergenic
917562008 1:176168399-176168421 CTGGGTGGGTGGGGGGAGTACGG + Intronic
917913590 1:179677739-179677761 CTGCTCTGGTGGAGGTAGCAGGG + Intronic
919027908 1:192201486-192201508 CTGCATGGGCGGAGCCCGCATGG - Intergenic
919525926 1:198650373-198650395 CTGAATGGGAGGATGGAGAAAGG + Intronic
919900878 1:202043454-202043476 CTGCGTGGTGGGAGGGAGCATGG + Intergenic
919973917 1:202598761-202598783 CTGGAAGGGTGGAGGGAGAGAGG + Intronic
920912819 1:210233566-210233588 CTGCCTGGGAGGAGGGTGCGGGG - Intronic
920931702 1:210394749-210394771 CTGGAAGGCTGCAGGGAGCAGGG + Intronic
921788516 1:219262721-219262743 CTGCTTTGGTGGAGGTGGCAGGG + Intergenic
922019292 1:221687792-221687814 GTGTATGGGTGGAGGGAGAGGGG - Intergenic
922857885 1:228790612-228790634 CTGCATGGCTGGAGAAAGCTGGG + Intergenic
922929458 1:229377474-229377496 CTGCAGGGGAGGCGGGAGCTTGG - Intergenic
923664596 1:235988860-235988882 GGACATGGGTGGAGGGAGAATGG + Intronic
924880125 1:248152157-248152179 CTGCTCAGGTGGAGGCAGCAGGG + Intergenic
924909574 1:248496517-248496539 ATGCTGTGGTGGAGGGAGCAGGG + Intergenic
924914528 1:248551543-248551565 ATGCTGTGGTGGAGGGAGCAGGG - Intergenic
1062786270 10:267837-267859 CAGCATGTGTGCAGGGACCACGG - Intergenic
1062841847 10:678884-678906 GAGCATGGGTGGGGGGAGGATGG - Intronic
1062841860 10:678914-678936 GAGCATGGGTGCGGGGAGCATGG - Intronic
1062842076 10:679564-679586 GAGCATGGGTGGGGGGAGGATGG - Intronic
1062877659 10:955281-955303 CTGGCTGGGTCGAGGGGGCAGGG - Intergenic
1063014700 10:2064309-2064331 CTGCAGGGGTGGAGGCCTCATGG - Intergenic
1063184518 10:3638712-3638734 CTGCCTGGGTGGAGGAAACCAGG + Intergenic
1063476096 10:6330352-6330374 CAGCGTGGGCGGCGGGAGCACGG + Intergenic
1064008642 10:11717518-11717540 CTGCAGGGGTGGGGTGAGCAGGG + Intergenic
1065045000 10:21739231-21739253 CGGGAAGGGTGGAGGGAGCCAGG - Intronic
1065261305 10:23926206-23926228 CGGGATGGGTGGAGGGGGCTGGG + Intronic
1065462404 10:25982553-25982575 CTGCACTGGTGGAGGTAGCAGGG - Intronic
1065497756 10:26347556-26347578 CTGCCTGGGAGGAGGGAGTTAGG - Intergenic
1066155452 10:32672103-32672125 AGGAATGTGTGGAGGGAGCATGG + Intronic
1066436142 10:35398051-35398073 GGGCATGGATGGAGGCAGCAGGG + Intronic
1066441660 10:35445290-35445312 CTGCATGGGTGGAGAGTGGGAGG - Intronic
1067010796 10:42711653-42711675 ATGGATGGGAGGAGGGAGAAGGG + Intergenic
1067091190 10:43266577-43266599 CTGAAGGGGCGGAGGGTGCAGGG + Intronic
1068770035 10:60810580-60810602 CTCCATTGGAGGAAGGAGCAGGG + Intergenic
1069551706 10:69368662-69368684 ATGCAGGGGTGTGGGGAGCAGGG + Intronic
1069648173 10:70019942-70019964 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1070915299 10:80150326-80150348 CTGCATGGGTGAAGGTTGAAAGG - Intergenic
1070975460 10:80602866-80602888 CTGCTTGAGTGGTGGGACCACGG + Intronic
1071761339 10:88611019-88611041 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1072015554 10:91342876-91342898 CCCCATGTGTGGAGGGAGGAGGG - Intergenic
1072253540 10:93600545-93600567 CCGAATGGGTGGAGGGAGGGAGG - Intronic
1072798349 10:98374068-98374090 CTTCAGGGGCTGAGGGAGCATGG - Intergenic
1072806987 10:98429930-98429952 CAGAAGGGGTGGAGGGAGCCAGG - Intronic
1073338768 10:102729605-102729627 CTGGATGTGTGGCGGTAGCAAGG + Intronic
1073417056 10:103392930-103392952 CTCCATGGGAGAAGGGAGAAGGG + Intronic
1074123741 10:110512162-110512184 CTGCGTAGGTGGAGGAAGGAAGG + Intergenic
1076371010 10:129953685-129953707 CTGTAGGGGTGGTGGGAGCAGGG - Intronic
1076538500 10:131198588-131198610 CTGCATGGGAGGGGGCAGCCAGG - Intronic
1076676140 10:132148697-132148719 CTGCACAGGAGGAGGGAGGAGGG + Intronic
1076722301 10:132397947-132397969 CTTCCTGGGTGGGGGGCGCAGGG + Intronic
1076777352 10:132705096-132705118 CTGCACCGTTGGTGGGAGCATGG + Intronic
1076838442 10:133032819-133032841 CTGCAGGTGTGCAGAGAGCAGGG + Intergenic
1076845144 10:133066115-133066137 GTGGATGGGTGGAGGGTGGATGG + Intergenic
1076845157 10:133066154-133066176 GTGGATGGGTGGAGGGTGGAGGG + Intergenic
1076845321 10:133066670-133066692 GTGGATGGGTGGAGGGTGGATGG + Intergenic
1076845363 10:133066782-133066804 GTGGATGGGTGGAGGGTGGATGG + Intergenic
1077013865 11:391558-391580 CTGCGTGGGTGGAGGGGGTTGGG - Intergenic
1077089775 11:773173-773195 CAGCAGGGGTGCAGGGAGGAAGG - Intronic
1077423033 11:2461834-2461856 CTGGGTGGGTGGAGAGAGAAAGG + Intronic
1077470743 11:2759406-2759428 CTGCATGTGTGCAGAGGGCAGGG + Intronic
1077526621 11:3069732-3069754 CTCCAAGTGTGGAGGGAGCGAGG - Intergenic
1077551595 11:3202957-3202979 CTGCCCTGGAGGAGGGAGCAAGG + Intergenic
1077834222 11:5910292-5910314 CTGCTCCGGTGGAGGTAGCAGGG + Intronic
1078091319 11:8266372-8266394 CAGCTTGGGTGGGGTGAGCATGG - Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1078997123 11:16713785-16713807 CTGCAGGAGTGGAAGGAGCTGGG - Intronic
1079056153 11:17208083-17208105 CTGCCGGGGTGGCGTGAGCAAGG + Intergenic
1079108417 11:17589119-17589141 CTGCATGGGTGCAGGTACAAAGG - Intronic
1079344479 11:19639944-19639966 CAGCATGGGTGAAGGGAAGATGG + Intronic
1080042184 11:27770516-27770538 ATGCATGAGTGGTGGGGGCAAGG + Intergenic
1080729779 11:34937464-34937486 CGGGGTGGGTGGAAGGAGCAAGG + Intronic
1080864040 11:36177711-36177733 CTGCTCAGGTGGAGGTAGCAGGG + Intronic
1081207351 11:40291677-40291699 GTGCGTGGGTGGAGGGAGAAAGG - Intronic
1081763577 11:45593762-45593784 CTGCAGGAGAGGAGTGAGCAAGG + Intergenic
1083312086 11:61789088-61789110 CTGCAGGGGTGGTGGGTGCTGGG - Exonic
1084322524 11:68381551-68381573 CTGCATGCGTGCAGGGAGGAAGG + Intronic
1085399987 11:76230243-76230265 AGGGATGGGTGGCGGGAGCAGGG - Intergenic
1086055307 11:82639860-82639882 CTTCATGGGTGTTGGGAGAAGGG - Intergenic
1087395359 11:97589824-97589846 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1087630367 11:100643399-100643421 TTGCCTGGGTTGAGGGAGTAAGG - Intergenic
1087807278 11:102568792-102568814 CTGCAGGGGTGGAGGCCTCATGG - Intergenic
1089004908 11:115083391-115083413 CTGCATGGAGGGAGGCAGGAAGG - Intergenic
1089220978 11:116871368-116871390 CTACAAGGGTGGAGTGAACAGGG + Intronic
1089259579 11:117214725-117214747 TTGCCTGGTTGGAGGTAGCAGGG + Intronic
1090831178 11:130421885-130421907 TTGCATTGGTGTGGGGAGCAGGG - Intronic
1091168510 11:133501099-133501121 CAGTGTGGGTGGTGGGAGCAGGG - Intronic
1091339308 11:134798050-134798072 CTGCATGGGTCTAAAGAGCAGGG + Intergenic
1091448287 12:557372-557394 CTGCCTGGGAGGAGGGAACGTGG + Intronic
1092527159 12:9316208-9316230 CTACTGGGGAGGAGGGAGCAGGG + Intergenic
1092540113 12:9415565-9415587 CTACTGGGGAGGAGGGAGCAGGG - Intergenic
1092693713 12:11144771-11144793 ATGCAGGGGTAGAGGAAGCAGGG - Intronic
1094161421 12:27394859-27394881 CTGCATGAATGCAGTGAGCAAGG + Intronic
1094512927 12:31106891-31106913 CTACTGGGGAGGAGGGAGCAGGG + Intergenic
1096568871 12:52507135-52507157 CAGCATAGCTGGAGGGAGCTGGG + Intergenic
1097251981 12:57639599-57639621 CTGGATGGATGGATGGAGCCCGG + Intergenic
1097694688 12:62764869-62764891 CTGCATGTGTGAAGGCCGCATGG + Intronic
1098376619 12:69822223-69822245 CTGGCTGGATGTAGGGAGCAAGG - Exonic
1098536266 12:71597006-71597028 CCCCATGGGGGGAGGGAGGAGGG - Intergenic
1098554124 12:71799299-71799321 CTGGAAGGGTTGAAGGAGCAGGG - Exonic
1099042040 12:77667902-77667924 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1099487777 12:83249485-83249507 CTGCAGGGGTGGAGAGCTCATGG + Intergenic
1100089586 12:90954198-90954220 CTGTATGAGTGGAGAGAGCCTGG - Exonic
1100184970 12:92129071-92129093 CTGCATGGAGGGAGGGGGAAGGG + Intronic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101259605 12:103014590-103014612 CTGCATGGGGCTAGGGAGGAGGG + Intergenic
1101838015 12:108308576-108308598 CAGCATGGGTCCAGGGAGCTGGG + Intronic
1103927077 12:124429173-124429195 CTGGCAGGGTGGGGGGAGCATGG - Intronic
1104114767 12:125738616-125738638 CTTCGTAGGTGGAGGCAGCATGG + Intergenic
1104804357 12:131575580-131575602 CAGCATGGGAGGTGTGAGCACGG - Intergenic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1105914324 13:24898441-24898463 CTGAATAGGTGGCCGGAGCAAGG + Intronic
1105922971 13:24982605-24982627 GTGCATGGGCGGAGGGAGCAGGG - Intergenic
1105990373 13:25614889-25614911 CTGCTTTGTTGGAGGTAGCAAGG + Intronic
1106143841 13:27034768-27034790 TTGAATGGGTGGGTGGAGCAAGG - Intergenic
1107361223 13:39619411-39619433 CTGCTTTGGTGGAGGTGGCAGGG - Intergenic
1107409688 13:40147072-40147094 CTGCATGGCAGAAGTGAGCATGG - Intergenic
1108064175 13:46560979-46561001 TTGCATGGCTGGAGTAAGCAAGG - Intronic
1108134271 13:47338535-47338557 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1108831714 13:54487334-54487356 CTGCTCTGGTGGAGGCAGCAGGG - Intergenic
1110542441 13:76721188-76721210 CTGCATGGGTGGAGGGGATATGG - Intergenic
1111225661 13:85267227-85267249 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1111329470 13:86745566-86745588 GTCCATGGGTGGAGGGAGAGTGG - Intergenic
1113072909 13:106438823-106438845 ATGGATGGGTGGAGGGAGGAAGG + Intergenic
1113743458 13:112726343-112726365 CTGCATGCGTGCAGGGAGAGGGG + Intronic
1113767656 13:112891042-112891064 CTGGGTGGCTGGAGGGAGCAGGG - Intergenic
1116044816 14:39731850-39731872 CTGCACTGGTGGAGGTAGCAGGG + Intergenic
1116629298 14:47309029-47309051 GTTCATGGGTGCAGGGAGTATGG - Intronic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1117498642 14:56330639-56330661 CTGGATGGGCTGAGGGAGCCTGG - Intergenic
1119004245 14:70908700-70908722 CTCCCTGGGGGGAGGGAGCGGGG + Intronic
1119421517 14:74510354-74510376 CTAGGTGGGAGGAGGGAGCATGG - Intronic
1119601611 14:75980625-75980647 ATGCATGGGGAGAGGGAGGAAGG - Exonic
1120448976 14:84641602-84641624 TTGCTTGGGTGGTGGGAGAAGGG - Intergenic
1120767419 14:88342183-88342205 ATGCATGGGTGGAGAGGGGAAGG - Intergenic
1121332818 14:93059270-93059292 AGGCAGGGGTGGAGGGAGTATGG + Intronic
1121358210 14:93232350-93232372 CTGCCTGGGAGGAGGGAGGAAGG - Intergenic
1122136348 14:99635140-99635162 CTGCAGGGGTGGAGGTCCCAGGG + Intergenic
1122290839 14:100679682-100679704 CGGGAAGGGTGGAGGGAGGAGGG - Intergenic
1122436795 14:101706225-101706247 ATGCAGGGGTCGCGGGAGCAGGG + Intergenic
1122958513 14:105083787-105083809 ATGGATGGGTGGAGGGAGGATGG - Intergenic
1123123254 14:105927791-105927813 CCGCAAGCCTGGAGGGAGCATGG - Intronic
1123405904 15:20019295-20019317 CCGCAAGCCTGGAGGGAGCATGG - Intergenic
1123515234 15:21025943-21025965 CCGCAAGCCTGGAGGGAGCATGG - Intergenic
1124689754 15:31812063-31812085 CTGCACTGGTGGAAGCAGCAGGG + Intronic
1124989957 15:34662953-34662975 CTGCTTGGGGGGAGGGGGGAGGG - Intergenic
1125685338 15:41560095-41560117 CTGAGAGGGTGAAGGGAGCAGGG + Intronic
1126198706 15:45960692-45960714 CTACATGAGTGCAGGGACCAGGG + Intergenic
1126211204 15:46103146-46103168 TTGCATGGGTGGAGGAACAAAGG - Intergenic
1126845384 15:52755248-52755270 CTCCAGGGATGGAGGGAGCCGGG - Intergenic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1127329026 15:57920994-57921016 TCCCATGGGTGGAAGGAGCAAGG - Intergenic
1127549554 15:60023384-60023406 CTGGATGGGGAGAGGGAACAGGG + Intronic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1128456379 15:67833854-67833876 CAGCATGGCTTGAGGGCGCAGGG - Exonic
1128513413 15:68327287-68327309 CTGAAGGGGAGGAGGCAGCAGGG - Intronic
1129273061 15:74429437-74429459 CTGCAGAGATGGAAGGAGCATGG - Intronic
1129606603 15:77028169-77028191 CTCCAGGGGTGGAGGGAGGAGGG + Intronic
1129631731 15:77267466-77267488 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
1130655932 15:85792235-85792257 GTGCAGGGGAGGAGGGAGGAGGG - Intronic
1130889823 15:88124303-88124325 CTGCCTGGGAGAGGGGAGCAGGG + Intronic
1131261664 15:90890977-90890999 CTGCAGCGGTGGAGGGAGCTGGG - Exonic
1132253732 15:100355557-100355579 CTGCTCCGGTGGAGGGAGCAGGG - Intergenic
1132301653 15:100779789-100779811 CTGCAGAGGTGGAGAGTGCAAGG - Intergenic
1132378857 15:101351746-101351768 CTTCATGGGTGGTGGGAAAATGG + Intronic
1132458105 16:35464-35486 CTGCCTGGGGGCTGGGAGCAGGG - Intergenic
1132550807 16:553176-553198 CTGCAGGGGTGGGGGGGGCATGG - Intronic
1132677189 16:1125705-1125727 CTGCGTGGGTGCCGGCAGCAGGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132909260 16:2299877-2299899 CTTCAGGGCAGGAGGGAGCAAGG + Intronic
1132939093 16:2498219-2498241 CTGCCTGAGGGGAGCGAGCAGGG - Exonic
1133233043 16:4375257-4375279 CCTCCTGGGTGGAGGGAGGAGGG + Intronic
1134573276 16:15309850-15309872 CAGAATGGGAGGAGGAAGCAGGG - Intergenic
1135293595 16:21260882-21260904 CTTCAGAGGTGGAGGGGGCAGGG - Intronic
1135592113 16:23712202-23712224 CAGCATGGCAGGAGGGAGAACGG + Intronic
1135883182 16:26279311-26279333 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1136005491 16:27326150-27326172 TTGCTTGGGTGGTGGGGGCACGG - Intronic
1136409408 16:30067381-30067403 CAGAATGGGTGGAGGGTGCAGGG + Intronic
1136555629 16:31006283-31006305 CTGCTCAGGGGGAGGGAGCAAGG - Intronic
1137063381 16:35811967-35811989 CAGCATGGGTGGAGGAAGGGAGG - Intergenic
1138788051 16:59869513-59869535 CAGGAAGGGTGGAGGGGGCAAGG + Intergenic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139214732 16:65116217-65116239 GAGCAAGGGTGGAGGAAGCAAGG - Intronic
1139590109 16:67928667-67928689 CTGCATGGGTGTTGGCAGCCTGG + Exonic
1139982737 16:70872795-70872817 CTGCATGGATGGATGGATGATGG - Intronic
1140854391 16:78965045-78965067 CTGCATGGGTGGAGCCCTCATGG + Intronic
1140855242 16:78972120-78972142 CTGCATTGGAGGAGGAAGCTTGG + Intronic
1141596457 16:85099990-85100012 AGGCAGGGGTGGTGGGAGCATGG - Intronic
1141804867 16:86335937-86335959 GAGGGTGGGTGGAGGGAGCAAGG - Intergenic
1142020770 16:87780856-87780878 AGGCGTGGGTGGAGGGAGGAAGG - Intergenic
1142206353 16:88784959-88784981 CTCCATGGCTGGAGGGCCCAGGG + Exonic
1142234385 16:88915007-88915029 GGGCAGGGGTGGAGGGAGGAAGG + Intronic
1142420327 16:89966062-89966084 CAGCAGGGGTGGAGGGGGCCAGG - Exonic
1142759526 17:2034750-2034772 CAGCAGGGGAGGGGGGAGCAGGG - Intronic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1142978106 17:3657072-3657094 CTGCCAGGGAGGAGGGAGGAGGG + Intronic
1143175585 17:4953151-4953173 CTGTCTGGGCTGAGGGAGCAGGG - Intronic
1143250688 17:5521127-5521149 GTGCATGGGGGGAGGGAGGCAGG - Intronic
1146677094 17:34781154-34781176 CTGCCTGGGTGAGGTGAGCAGGG + Intergenic
1147755264 17:42763164-42763186 CTTCATGGAGGCAGGGAGCAGGG - Intergenic
1148442938 17:47721144-47721166 CTGGAGGGGTGGAGGGGGAAGGG + Intergenic
1148957499 17:51365866-51365888 CTGCATGGGTGTAAGGAACATGG - Intergenic
1149579822 17:57741827-57741849 TCGCATGGCTGCAGGGAGCATGG - Intergenic
1150812011 17:68364020-68364042 GTGCCTGGGTGGAGGGAGGCAGG - Intronic
1151185400 17:72360517-72360539 CTGCATGGGTGCAGTAGGCAGGG - Intergenic
1151583015 17:74990775-74990797 CTGGATGGTGGGACGGAGCACGG + Intronic
1151877034 17:76872733-76872755 GTGCATGAGTGAAGGAAGCAAGG - Exonic
1151888359 17:76937523-76937545 ATGCATGGATGGTGGGTGCATGG + Intronic
1152029641 17:77834136-77834158 CTGCTGGGGTGGTGGGGGCAGGG - Intergenic
1152192461 17:78897044-78897066 CTGCCTGGGTGGAGGGTCCCTGG - Intronic
1152473337 17:80502625-80502647 GCACATGGGTGGGGGGAGCAAGG - Intergenic
1152544412 17:80993472-80993494 CTCCGTGGGTGGAGGGAACCGGG + Intronic
1152600536 17:81260030-81260052 CTGCCTGTGTGCAGGGAACATGG - Intronic
1152859887 17:82690212-82690234 CTGCAGAATTGGAGGGAGCACGG + Intronic
1152859917 17:82690450-82690472 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859927 17:82690530-82690552 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152859939 17:82690610-82690632 CTGCAGAATTGGAGGGAGCATGG + Intronic
1152903063 17:82956453-82956475 CTGCATGGGTGTGGGGGGGATGG - Intronic
1153071860 18:1115583-1115605 CTGCTGTGGTGGAGGTAGCAGGG + Intergenic
1154090070 18:11349778-11349800 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1156449884 18:37260987-37261009 CAGCATGGTTGGAGGGGACAGGG - Intronic
1157092537 18:44653065-44653087 CTGCATTGGTGGAGGCAGGAGGG - Intergenic
1157621023 18:49017574-49017596 CAGGTTTGGTGGAGGGAGCAGGG - Intergenic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1160015084 18:75134085-75134107 CAGCATGTGTGCTGGGAGCAGGG + Intergenic
1160312442 18:77808479-77808501 TTCCAAGGGTGGAGGGAGGAAGG - Intergenic
1160583385 18:79900139-79900161 CAGCCAGGGAGGAGGGAGCACGG + Intronic
1160752591 19:741477-741499 CTGCAGGGGTGAGGGGAGCTGGG + Intronic
1160767821 19:816270-816292 CTGCATGGGTGGATGATGGATGG - Intronic
1160767962 19:816857-816879 CTGCATGGGTGGATGATGGATGG - Intronic
1160861741 19:1240123-1240145 CCCCAGGGGTGCAGGGAGCAGGG - Intergenic
1160970505 19:1765810-1765832 CTGCAGTGGTGAGGGGAGCAGGG + Intronic
1161105286 19:2440809-2440831 CTGGATGGGTGGACGGATGATGG - Intronic
1162025284 19:7890264-7890286 AGGCATGGGTGGATGGAGCCAGG + Intronic
1162062796 19:8107078-8107100 ATGAATGGGTGGATGGGGCATGG + Intronic
1163383656 19:16985738-16985760 ATGGATGGGTGGAGGGAGGGAGG + Intronic
1163690028 19:18733502-18733524 TTACATGAGTGGAGGGAGCAAGG + Intronic
1165027016 19:32969572-32969594 CTGCAGGGATGGAGGGTGAAGGG + Intronic
1165950973 19:39473753-39473775 CTGCCTGGGTGGAGTGACCTTGG + Intronic
1165961191 19:39535789-39535811 CTGCATGTGTGCAGGGAGACTGG + Intergenic
1166137447 19:40786161-40786183 TTGCATGGGATGGGGGAGCATGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166178409 19:41090381-41090403 CTGCAGGTGTGGCGGGAGAAGGG - Intronic
1166534256 19:43562296-43562318 CTGTATGGAAGGAGGGAGCCTGG + Intronic
1166585955 19:43949231-43949253 CAGCAGTGGTGGAGGCAGCATGG + Intergenic
1167792985 19:51692297-51692319 CTGCCTGGCCGGAGGGAGGAGGG + Intergenic
1168141855 19:54393389-54393411 CTCTATGGGGTGAGGGAGCAGGG + Intergenic
1168213150 19:54906380-54906402 GTGCTTGGGTGGAAGGAGCTTGG - Intronic
1168267282 19:55229853-55229875 CAGCCTGGGAGGAGGGAGCTGGG + Exonic
924959502 2:21363-21385 CTGCATGGGCGGCGGGAGGCTGG + Intergenic
925204415 2:1994267-1994289 CTCGCTGGGAGGAGGGAGCAGGG - Intronic
925204432 2:1994320-1994342 CTCGCTGGGAGGAGGGAGCAGGG - Intronic
925204450 2:1994373-1994395 CTCGCTGGGAGGAGGGAGCAGGG - Intronic
925347763 2:3182906-3182928 CTGGATGGGTGGATGGATGATGG - Intergenic
925652270 2:6104008-6104030 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
925705591 2:6681817-6681839 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
926308812 2:11659755-11659777 CAGCCTGGGAAGAGGGAGCACGG - Intronic
926346074 2:11946873-11946895 CTTCCTGGGTGGATGGAGGAAGG + Intergenic
926737913 2:16088263-16088285 AAGGAGGGGTGGAGGGAGCAAGG + Intergenic
927203874 2:20594839-20594861 CTTCATGGATGGAAGGGGCAAGG + Intronic
927685859 2:25169854-25169876 CTGGATGGCTGGAGAGAGGAAGG - Intergenic
927759760 2:25742401-25742423 TTGCAGGGGTGGAAGGAGTAGGG + Exonic
928923052 2:36545992-36546014 CTGGAGGGGTGGTGGGAGCAGGG - Intronic
929083625 2:38146749-38146771 CTGCGGGGGTGGCGGGAGAAGGG - Intergenic
929471306 2:42196760-42196782 CTGCATGGGCAGAGGGGGAAGGG - Intronic
929763172 2:44822781-44822803 ATGAATGGGTGCAGGGAGTAGGG - Intergenic
930166901 2:48211772-48211794 CCGCATGGGACTAGGGAGCAAGG - Intergenic
930423007 2:51177255-51177277 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
931442022 2:62296750-62296772 GTACATGGGAGGAGGGAGCCAGG + Intergenic
931442977 2:62304408-62304430 CTTCAGGTGTGGAGGGAGGAGGG - Intergenic
931803880 2:65785873-65785895 CTGAAAGGGTGGAGGGAGCAAGG + Intergenic
932180725 2:69643772-69643794 CTGGTTGGGTGGATGGAGCCGGG - Intronic
932769138 2:74490747-74490769 GAGCATGGCTGGAGGGTGCAGGG + Intronic
933118167 2:78500129-78500151 TGTCATGGGTGGAGGGAGCGGGG - Intergenic
934904097 2:98184277-98184299 CTGCAAGGATGGAAGGAGAAAGG - Intronic
935088416 2:99870510-99870532 CTGCATGGGTAGATCCAGCAGGG - Intronic
935170323 2:100606511-100606533 CTGCAGAGGTGGAGGAATCACGG + Intergenic
935949168 2:108313252-108313274 CTCCATAGGTGTAGGGACCATGG + Intergenic
935949674 2:108317265-108317287 CTGCAGGGGTGGAAGTGGCAGGG - Intergenic
936145868 2:109980359-109980381 CAGCGTGGCTGGAGGGAGCTGGG - Intergenic
936198822 2:110391119-110391141 CAGCGTGGCTGGAGGGAGCTGGG + Intergenic
936504913 2:113098477-113098499 TTGCTTTGGTGGAGGCAGCAGGG + Intergenic
936701115 2:115012438-115012460 CTGCTTTGGTGGAGGCAGCAGGG - Intronic
937639658 2:124197221-124197243 CTGCAAAGGTGGAGGAAGGAGGG - Intronic
937795173 2:126009001-126009023 ATGCATGTGTGGAGGGGGTAGGG + Intergenic
937913466 2:127087530-127087552 CAGCGTGAGTGGAGGCAGCAGGG + Intronic
938564190 2:132503457-132503479 CTGCTTTGATGGAGGTAGCAGGG + Intronic
938996440 2:136683567-136683589 CTGCTTTGGTGGAGGTAGCAGGG - Intergenic
939219397 2:139282024-139282046 CTGCTTTGGTGGAGGTGGCAGGG - Intergenic
939833065 2:147095823-147095845 TTGCCTTGGTGGATGGAGCATGG - Intergenic
940045872 2:149409291-149409313 CTGCTCTGGTGGAGGTAGCAGGG + Intronic
940121917 2:150276740-150276762 CTGCATGGGTGGAGCCTTCATGG - Intergenic
941977747 2:171424217-171424239 CTGCATGGGTGGAGCCCTCATGG + Intronic
942991510 2:182208260-182208282 CTGCATGGCTGGTGGGGGCAGGG + Intronic
943449309 2:188028387-188028409 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
943792420 2:191948440-191948462 CTTCATGGGTTGGGTGAGCATGG + Intergenic
944238856 2:197466173-197466195 TTACGTGGGAGGAGGGAGCAGGG - Intronic
944413190 2:199461972-199461994 GCGCCTGGGTGGAGGGTGCAGGG + Intronic
945048807 2:205804630-205804652 CTTCATTGATGGAGTGAGCAAGG - Intergenic
946062833 2:216959535-216959557 CTGCAAGGGGAGTGGGAGCAGGG + Intergenic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946200854 2:218069936-218069958 CTGCGTGTGTGTGGGGAGCAGGG - Intronic
946201210 2:218071849-218071871 CTGCCTGTGTGTGGGGAGCAGGG - Intronic
946254521 2:218433021-218433043 GGGGATGGGTGGTGGGAGCAGGG + Intronic
946709562 2:222492268-222492290 CTGCAGGGGTGGAGGCCTCATGG - Intronic
947613120 2:231536122-231536144 CTGCATGGGTGGGGTGAGCATGG + Intergenic
947667879 2:231918609-231918631 CTGCAAGGGTGGTGGGAGATAGG - Intergenic
948151007 2:235744609-235744631 CTGCATGGCGGCAGGCAGCAGGG - Intronic
948576779 2:238956896-238956918 CTGCTCTGGTGGAGGAAGCAGGG - Intergenic
948757053 2:240165964-240165986 CTCCATGTGTGGAGGGAGGGAGG + Intergenic
948953064 2:241267454-241267476 CCGCAGGGGTGGGGGGACCATGG + Intronic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
949056953 2:241932904-241932926 CTGCCTGGTTGGAAGGCGCAAGG - Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1169346276 20:4830337-4830359 CTGCTTTGGTGGTGGGGGCAAGG - Intergenic
1169829637 20:9810090-9810112 CTGCACAGGTGGAAGGAGCCTGG - Intronic
1170086308 20:12535902-12535924 CTGCTTTGGTGGAGGTAGCAGGG - Intergenic
1170201529 20:13749532-13749554 CTGAATGGGTAGATTGAGCAAGG + Intronic
1170650807 20:18239328-18239350 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1170741097 20:19057198-19057220 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1170963818 20:21049045-21049067 CTGGGAGGGTGGAGGGAGAATGG + Intergenic
1171869566 20:30514239-30514261 CTGCAGGGGAGGGGGGAGGAGGG + Intergenic
1172617237 20:36297467-36297489 CTGAAGGTGTGGAGTGAGCAAGG - Intergenic
1173620856 20:44434845-44434867 CTACCTGGGTGGTGGAAGCATGG - Intergenic
1174421986 20:50405285-50405307 CTGTAGGGGTGGCGGGAGAAGGG - Intergenic
1175367834 20:58467659-58467681 CTGCAGGGGTGGAAGGAGATGGG + Intronic
1175658070 20:60789356-60789378 CTTGCTGGGTGGAAGGAGCATGG + Intergenic
1175737621 20:61398349-61398371 CTCTAAGGGTGGAGAGAGCAGGG + Intronic
1175779238 20:61671835-61671857 ATGCATGGGTGGAAGGTGGATGG + Intronic
1175934700 20:62509474-62509496 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175934969 20:62510200-62510222 CTGGAAGGGTGGAGGGTGGAGGG - Intergenic
1175934997 20:62510276-62510298 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1176076839 20:63252503-63252525 CTGCATGGGGGTAGGGGGCCCGG - Intronic
1176293402 21:5058335-5058357 CTGCAGGGGTGGAGGTTGCAGGG - Intergenic
1177515682 21:22148338-22148360 CTGCATGGGTGGAGTCCTCATGG + Intergenic
1177969945 21:27777420-27777442 CTGCAAGGGTGGAAGGAGTGGGG - Intergenic
1178732922 21:35121061-35121083 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
1178943336 21:36925631-36925653 CTGCAGGGGTGGAGGGTGGGGGG + Intronic
1179035570 21:37756376-37756398 GAGAATGGGTGGTGGGAGCAGGG + Intronic
1179407254 21:41136355-41136377 CTGCAGGGCTGGTGGGAGCCAGG + Intergenic
1179443394 21:41411805-41411827 CTGCCCTGGTGGAGGTAGCAGGG - Intergenic
1179863858 21:44205313-44205335 CTGCAGGGGTGGAGGTTGCAGGG + Intergenic
1180003189 21:45004312-45004334 CTTCCTGGGTGGAGGCACCAGGG + Intergenic
1180245606 21:46545517-46545539 CTGCATGGGAGGAGGGTGTGTGG + Intronic
1180255085 21:46621432-46621454 CTGAATGGATGAAGGGAGAAGGG - Intergenic
1180322162 22:11332102-11332124 CTGCATGGGTGGAGCCCTCATGG - Intergenic
1180840832 22:18958161-18958183 CCGGCTGGGTGGACGGAGCATGG - Intergenic
1181040034 22:20187778-20187800 CTGCATGGCTGGGTGGAGCCAGG + Intergenic
1181060655 22:20280613-20280635 CTGGCTGGGTGGACGGAGCATGG + Intronic
1181418911 22:22783628-22783650 CTGCATTGGAGGAGGGACAAGGG - Intronic
1181426864 22:22849288-22849310 CTGTCTGGCTGGAGGGACCAGGG + Intronic
1181459429 22:23077601-23077623 CAGCAAGGGAGGAGGGGGCAAGG + Intronic
1181804101 22:25364828-25364850 CTGCATGCGTGCAAGGAGGAAGG - Intronic
1182242256 22:28925440-28925462 GTGCATGGGTAGAGGCATCATGG - Intronic
1182574329 22:31262689-31262711 CTGCATGTGAGGAGCGAGCCGGG - Exonic
1182665792 22:31958924-31958946 CTGCTTGGGAGGATGGAGCCCGG + Intergenic
1182764248 22:32747008-32747030 CTCCCTGGCTGGAGGGAGCCTGG + Intronic
1183030766 22:35102839-35102861 TTGCAGAGGTGGAGGGAGAAGGG - Intergenic
1183512374 22:38243697-38243719 CAGCCTGCGAGGAGGGAGCATGG + Intronic
1183977297 22:41519977-41519999 TTGCAGGGCTGGAGGGAGCCCGG + Intronic
1184388683 22:44190733-44190755 CTGCATGGGTGGAGCTGGCTGGG + Intronic
1185025257 22:48405222-48405244 CTGCAACGGTGAAGGGAGCCAGG - Intergenic
1185097762 22:48821049-48821071 CTGCATGTGTGGAGCCAGGATGG - Intronic
1185222416 22:49635816-49635838 CTGCAGGGGTGAGGGGTGCAGGG + Intronic
949749379 3:7333255-7333277 CTGCTCAGGTGGAGGTAGCAGGG - Intronic
949985598 3:9538186-9538208 CTTGATGGGAGGAGGGAGCCCGG - Intronic
950554513 3:13687146-13687168 CTCCTTGTGTGGAGGGAGGACGG + Intergenic
950902070 3:16506660-16506682 CTGCTTGGGTGGAGTTAACATGG - Intronic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
952082927 3:29782285-29782307 CTGCTTTGGTGGAGGTAGCAGGG - Intronic
952182764 3:30935870-30935892 CTGCTTGGGTGATGGGTGCACGG - Intergenic
952245035 3:31578689-31578711 CTGCATGCATGGAAGGAGAAAGG - Intronic
953075358 3:39564941-39564963 CTATTTGGGTGAAGGGAGCATGG + Intergenic
953442319 3:42928950-42928972 CTGAATGGCTTGAGAGAGCAGGG - Intronic
953482574 3:43264329-43264351 CGCCATGAGTAGAGGGAGCATGG + Intergenic
953531553 3:43744517-43744539 CTGCAGGGGTGGAGGGGTCCAGG - Intergenic
954522608 3:51242752-51242774 CTGCAATGGTGGTGGGAGCAGGG + Intronic
954762161 3:52882858-52882880 GTGCATGGGAGGATGGAGAAAGG + Intronic
954994275 3:54867204-54867226 CTGCATGGGAGAAGGGAGATTGG + Intronic
955445710 3:59007620-59007642 CTGCTCTGGTGGAGGTAGCACGG - Intronic
955450702 3:59064227-59064249 CTGCTCGGGTGGAGGTAGGAGGG + Intergenic
955832143 3:63015755-63015777 CTGCATGGGTGGGGGAAGGGTGG - Intergenic
956447648 3:69341485-69341507 CTGCAGGAGTGGAGGTGGCAAGG + Intronic
956465763 3:69519283-69519305 GTGCATGGCTGGGGAGAGCAGGG + Intronic
956935541 3:74096640-74096662 CAGCATGGGGGGAGGGAGCATGG + Intergenic
957195851 3:77066968-77066990 TTGCAGGGGTGGAGGGGGGAGGG - Intronic
959387704 3:105732769-105732791 CTGCATGAGTTGAGGAAGGATGG - Intronic
959611653 3:108301723-108301745 CTGCTTGAGTTGAGGGAGAAAGG - Intronic
959877872 3:111407283-111407305 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
960966191 3:123106488-123106510 CTACCTGGCTGGAGTGAGCAAGG + Intronic
961461073 3:127050800-127050822 CTCCATGGGTGGAGGCAGAGGGG - Intergenic
961519265 3:127457218-127457240 CGGCAGGGCTGGCGGGAGCAGGG - Intergenic
961863457 3:129936497-129936519 CTGCAGGGGGGAAGGGAGAATGG + Intergenic
962034497 3:131636793-131636815 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
962226744 3:133618337-133618359 CAGCAAGGGAGGAGAGAGCAAGG - Exonic
962368003 3:134798324-134798346 CTGCCTGGGTGGAAGGAGGGAGG + Intronic
962390861 3:134971460-134971482 ATGGATGGGTGGATGGAGCGAGG + Intronic
964331614 3:155609149-155609171 CTGCTTTGGTGGAGGTGGCAAGG - Intronic
964393207 3:156218644-156218666 CTGCTTCAGTGGAGGTAGCAGGG - Intronic
965184613 3:165446865-165446887 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
966354706 3:179067711-179067733 CTGCTTAGGTGGAGGAAGCACGG + Exonic
966542663 3:181108940-181108962 CTGTATGGGAGGAGATAGCATGG + Intergenic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966747974 3:183296416-183296438 CTTCAGGGCTGGAGGGAGCCTGG - Intronic
966923392 3:184629163-184629185 CTGCCTGGGTGTAAGGAGGAGGG - Intronic
967131116 3:186471593-186471615 GTACAGGGGTGGTGGGAGCAAGG - Intergenic
968066129 3:195760709-195760731 CTGCAAGGATGGAGAGAGCCAGG + Intronic
968617126 4:1582474-1582496 CAGCCTGGGTGCAGGGTGCAGGG - Intergenic
968651247 4:1761119-1761141 CTGCATGGTGGGAGGGGGCCCGG - Intergenic
968749252 4:2378724-2378746 TTGGGTGGGTGGATGGAGCAGGG - Intronic
968961947 4:3750109-3750131 CTGCATGTGTGCAGGAGGCAGGG + Intergenic
969321758 4:6417000-6417022 AGGCAGGTGTGGAGGGAGCAGGG - Intronic
969623298 4:8289738-8289760 CTCCTTGGGTGCAGGGAGGATGG + Intronic
969623331 4:8289856-8289878 CTCCTTGGGTGCAGGGAGGATGG + Intronic
969623349 4:8289916-8289938 CTCCTTGGGTGCAGGGAGGATGG + Intronic
969623367 4:8289976-8289998 CTCCTTGGGTGCAGGGAGGACGG + Intronic
969643554 4:8413175-8413197 GTGCAGGGGTGGAGGGAGATGGG - Intronic
971201581 4:24514029-24514051 CAGCAGGGGGAGAGGGAGCACGG + Intergenic
972565070 4:40262374-40262396 CTGCAGGGGGTCAGGGAGCAGGG - Intergenic
972806515 4:42533776-42533798 CTGCTTTGGTGGAGGTAGCAGGG - Intronic
972826840 4:42768402-42768424 CTGCTCCGGTGGAGGTAGCAGGG - Intergenic
973730272 4:53816239-53816261 GTGCAAGGGTGGACGCAGCATGG + Intronic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
974583388 4:63836708-63836730 CTGCCCTGGTGGAGGTAGCAGGG + Intergenic
974941720 4:68477516-68477538 CTGCATTTGTGTAGGGAACAGGG - Exonic
976129603 4:81870635-81870657 CAGAATGGGTGCTGGGAGCAGGG - Intronic
976887903 4:90008149-90008171 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
976918203 4:90404618-90404640 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
977097446 4:92764201-92764223 TTGCATGGTTGGAGGGAGGCTGG + Intronic
978916143 4:114127821-114127843 CTGCTTTGGTGGAGGCAGCAGGG - Intergenic
979149993 4:117299612-117299634 CTGGATGGGTGGTGGGGGAATGG - Intergenic
979600887 4:122585759-122585781 CTAGATGGATGGATGGAGCATGG + Intergenic
980409903 4:132403666-132403688 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
980861008 4:138499730-138499752 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
981238583 4:142447841-142447863 CTACATGAGAGGAGGCAGCAAGG + Intronic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982455907 4:155609286-155609308 CTAGATGGGTGGAGGTGGCAAGG - Intergenic
983754738 4:171320534-171320556 CTGCCCTGGTGGAGGTAGCAGGG - Intergenic
984190559 4:176600881-176600903 CTGCTTTGGTGGAGGTAGCAGGG + Intergenic
984318557 4:178161223-178161245 CTGCATGGGTGGAGCCCTCATGG - Intergenic
985326389 4:188775825-188775847 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
985606732 5:861975-861997 CAGCCACGGTGGAGGGAGCAGGG - Intronic
985887863 5:2694157-2694179 AGGGATGGGTGGAGGGAGAAAGG + Intergenic
986134234 5:4959326-4959348 CTCCAAGGGTGGCTGGAGCAGGG - Intergenic
986712509 5:10498240-10498262 CTGGATGGGTGAGGGGAGGAGGG + Intergenic
987155888 5:15089408-15089430 TTGCTTGGGTGCTGGGAGCATGG - Intergenic
987201333 5:15580859-15580881 ATGCATGGCTGGAAGGGGCATGG + Intronic
987744105 5:21948096-21948118 CTGCAGGGGTGGAGCCATCATGG + Intronic
987846643 5:23295792-23295814 CTGCTTCAGTGGAGGTAGCAGGG + Intergenic
989170521 5:38467529-38467551 CTGCGTGGGAGGAAGGAGCTCGG + Intergenic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989431493 5:41360744-41360766 CTGCTCTGGTGGAGGTAGCAGGG + Intronic
991045850 5:62221888-62221910 CTGGAAGGGTGGACGCAGCAGGG - Intergenic
991623042 5:68565953-68565975 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
992441485 5:76801274-76801296 CTGTGTGGCTGGAGAGAGCATGG + Intergenic
992898701 5:81270718-81270740 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
993862518 5:93153492-93153514 TTCCATGGGTAGAGGGAGGAGGG - Intergenic
994146698 5:96403042-96403064 GTGCATGTGTGGAGGCAGGAAGG + Intronic
994452209 5:99956385-99956407 CTGCATGGGTGGCAGGAGCCAGG - Intergenic
994597750 5:101860742-101860764 CTCCAGTGGTGGAGGCAGCACGG - Intergenic
995002987 5:107158001-107158023 CTGCCTGGGTGGGGGAAGGAAGG + Intergenic
996141282 5:119912895-119912917 CTGCTTTGGTGGAGGTGGCAGGG + Intergenic
996232951 5:121088411-121088433 CTGCATAGGAAGAGGAAGCATGG + Intergenic
997250131 5:132382315-132382337 CCCCATGGCTGGAGGGGGCATGG - Intronic
997397650 5:133577263-133577285 CTGCATAACTGGAGGAAGCAGGG - Intronic
997599943 5:135132291-135132313 CTGCATGGGTGGTGGGAAGTGGG - Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997775626 5:136601861-136601883 CTGCAGGGGTGGAGGCTTCATGG + Intergenic
997854022 5:137357225-137357247 CTGAATGGATGGAGTTAGCACGG - Intronic
998153874 5:139773210-139773232 TTGCAGGGGTGGAGGGTGCTGGG - Intergenic
999086153 5:148892160-148892182 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
999324223 5:150633133-150633155 GTGCATGGGTGGGGGAAACAGGG + Intronic
999519106 5:152332126-152332148 CTGCTTGTGTGGAGGGGGCAGGG + Intergenic
999692288 5:154158526-154158548 CTGCATGTGTAGGGAGAGCAGGG - Intronic
1000075235 5:157778363-157778385 CTGGATGGGTGGAGGAAGCGAGG - Intergenic
1000548842 5:162634103-162634125 CTGCAAGGGTGGAGGCTTCATGG - Intergenic
1001907079 5:175481648-175481670 CTGCATGGGAGGGGAGAACATGG + Intronic
1001964304 5:175899778-175899800 CTCCATGGGATGAGGCAGCAGGG - Intergenic
1003045190 6:2727446-2727468 GTGCATGGGGGCAGGGATCAGGG - Intronic
1003282432 6:4705689-4705711 GTGCAGGGGTGCAGGGAGGATGG - Intergenic
1003869658 6:10391398-10391420 CTGCCTGGGAGGAGGCAGCGCGG - Intergenic
1004319519 6:14621562-14621584 CTGCATGGGTGTGGTGAGCTGGG - Intergenic
1004834122 6:19511615-19511637 CAGCATGGCTGCAGGGTGCAGGG + Intergenic
1005244168 6:23862448-23862470 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1006381889 6:33703519-33703541 CTCCAAGGCTGTAGGGAGCAGGG + Intronic
1006852098 6:37106042-37106064 CAGCATGGGTAGAGGCAGGAAGG + Intergenic
1007070672 6:39035900-39035922 CCGCATGGGGTGAGGGGGCACGG + Intergenic
1007694872 6:43725625-43725647 CAGGATTGGTGGAGAGAGCAGGG - Intergenic
1007944468 6:45813151-45813173 CTGCCTGGGTAAAGGGAGCTGGG + Intergenic
1008668968 6:53747199-53747221 TTGGATGGCTGGAGGGAGTAAGG - Intergenic
1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG + Intronic
1010027865 6:71240307-71240329 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1010518411 6:76802925-76802947 CTGCTCCGGTGGAGGTAGCAGGG + Intergenic
1011723512 6:90184467-90184489 GTGAAGGGGTGGAGGGAGGAAGG - Intronic
1012153218 6:95782001-95782023 TTGCATGGGAGGGGGAAGCAGGG - Intergenic
1012273510 6:97243952-97243974 CTGCTCTGGTGGAGGTAGCAGGG + Intronic
1012525320 6:100170202-100170224 CTGAAGGGGTGGAGGGGGAAGGG - Intergenic
1013155775 6:107490176-107490198 CCGCATGGGCGCGGGGAGCAAGG - Exonic
1014057123 6:117028954-117028976 CTTCATGGGTGGAGGGAGCAAGG + Intergenic
1014266466 6:119283618-119283640 CTTGGTGGGTGGAAGGAGCAGGG + Intronic
1014481984 6:121950654-121950676 CTGCCCTGGTGGAGGTAGCAGGG + Intergenic
1014520711 6:122439094-122439116 CTGCAGGTGTGGAGAGTGCAAGG + Intergenic
1014566614 6:122956680-122956702 CTGATTTGGTGGAGGTAGCAGGG - Intergenic
1014962453 6:127703980-127704002 TTACATGGCAGGAGGGAGCAAGG + Intergenic
1015557854 6:134481722-134481744 TTGCAAGGGTGAAGGGAGGATGG + Intergenic
1015644164 6:135368227-135368249 CTGCGCTGGTGGAGGTAGCAGGG + Intronic
1015899920 6:138053720-138053742 CTGCAGCAGTGGAGGTAGCAGGG - Intergenic
1016216262 6:141607649-141607671 CTGCACTGGTGGAGGTAGCAGGG + Intergenic
1016317776 6:142808776-142808798 ATGAATGGATGGAGGGAGGAAGG + Intronic
1016351701 6:143176191-143176213 CTGCTCTGGTGGAGGTAGCAGGG + Intronic
1017657966 6:156648233-156648255 ATTCATGGGTGGAGGGAGGAAGG - Intergenic
1017743796 6:157429063-157429085 CTGCATGGATGGTGGGGGCGTGG + Intronic
1017954994 6:159169853-159169875 CTGTGTGGGTGGCGGGAGCGGGG + Intronic
1018341497 6:162855953-162855975 CGGCATGGGTGGAGGTGGCCTGG - Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019062217 6:169264773-169264795 CAGCATGGTGGGAGAGAGCAGGG + Intergenic
1019103366 6:169649903-169649925 CTGCATGGGTGGCTGGATGAAGG - Intronic
1019476188 7:1245587-1245609 CTTCAAGGATGGAGGAAGCATGG - Intergenic
1019575901 7:1737503-1737525 CTGGATGGGTGGAGGGCGAGTGG - Intronic
1019699968 7:2470063-2470085 GTGCATGGTTGGAAGGAGCTGGG + Intergenic
1019709917 7:2513532-2513554 CAGGCCGGGTGGAGGGAGCAGGG - Intronic
1019716016 7:2539726-2539748 TCGCAGGGGTGGAGGCAGCAGGG - Intronic
1019755178 7:2763465-2763487 CTGCCGGGGTTGAGGGAGCTCGG - Intronic
1020056497 7:5121228-5121250 CTGCATGGGTGAAGAGACCGTGG - Intergenic
1020081484 7:5288251-5288273 CTGGGTGGGTGAAGGGACCATGG + Intronic
1020171404 7:5847745-5847767 CTGCATGGGTGAAGAGACCGTGG + Intergenic
1020212717 7:6167891-6167913 CTGCATGGGAGGTGTGAGCGGGG - Intronic
1022112078 7:27238103-27238125 CTGCATGGCTGGAAGGCTCAGGG - Intergenic
1022231667 7:28420066-28420088 CTGATTGGATGGAGGCAGCATGG + Intronic
1023935698 7:44738263-44738285 GACCCTGGGTGGAGGGAGCATGG + Intergenic
1024212576 7:47218440-47218462 CCTCATGGGTGGAGGGAGAGGGG + Intergenic
1024238268 7:47414478-47414500 CTGCATGGGACAAGGGAGGAGGG + Intronic
1024367252 7:48535395-48535417 CTGCTCAGGTGGAGGTAGCAGGG + Intronic
1024578118 7:50781405-50781427 CAGCATCGGGGGTGGGAGCAGGG - Intronic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1024715086 7:52069857-52069879 CTGCATCTGTGAAGGGACCAGGG - Intergenic
1024927008 7:54627775-54627797 CTGCATTGGGGGAGGCTGCATGG - Intergenic
1026132194 7:67629936-67629958 TTGTATGGGAGGAGGGAGGAAGG - Intergenic
1026282339 7:68933098-68933120 CTGCATGCCTGGAGTGAGCAGGG - Intergenic
1026569697 7:71518683-71518705 CTCCTTGGGCGGAGGGAGAAAGG + Intronic
1026907135 7:74069022-74069044 CTTCCTGGGGGGAGGGAGGAGGG + Intronic
1026973002 7:74479308-74479330 CTGCATGGCTGGAGTGTGCAGGG - Intronic
1027035275 7:74920636-74920658 GTGGAGGGGTGGAGGGAGTAAGG - Intergenic
1027287232 7:76659330-76659352 CTTCATGGTGGGAGGAAGCATGG - Intergenic
1028197803 7:87927216-87927238 TTGCTTTGGTGGAGGTAGCAGGG - Intergenic
1028261734 7:88674513-88674535 CTGCTCTGGTGGAGGCAGCAAGG - Intergenic
1028822630 7:95229918-95229940 CTGCTTTGATGGAGGTAGCAAGG - Intronic
1029394778 7:100300504-100300526 GTGGAGGGGTGGAGGGAGTAAGG + Intergenic
1030745850 7:113165572-113165594 CTGAATTGCGGGAGGGAGCAAGG + Intergenic
1031569736 7:123344308-123344330 GTTGTTGGGTGGAGGGAGCAGGG - Intergenic
1031655414 7:124349211-124349233 CTGCTATGGTGGAGGCAGCAAGG + Intergenic
1033494063 7:141876500-141876522 CTACAGTGGTGGAGGCAGCAGGG + Intergenic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1033806143 7:144956105-144956127 CTGCATAGATGGAGGGGACAGGG - Intergenic
1034229962 7:149516217-149516239 CTGCATGGGAGCAGGGTGCAGGG - Intergenic
1034264176 7:149773306-149773328 CTGCAAGGGAGGAGGGACCGAGG + Exonic
1034347917 7:150398278-150398300 CAGCGTGGGTTGAGGGAGGAGGG + Exonic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034724410 7:153321980-153322002 CTGGATGTGAGGAGAGAGCATGG - Intergenic
1034742927 7:153495257-153495279 CTGCAGGGGTGGAGCCTGCATGG + Intergenic
1035125262 7:156604500-156604522 GTGCATTGGTGGAGGGAACGTGG - Intergenic
1035371992 7:158385969-158385991 GGGCATGGGAGGAGGGAGGAGGG - Intronic
1035372082 7:158386240-158386262 GGGCATGGGAGGAGGGAGGAGGG - Intronic
1035754923 8:2023852-2023874 CTGCAGGGGAGGAAGCAGCAGGG + Intergenic
1035770385 8:2142618-2142640 CTGCAAGGGAGGAGGGAGGGAGG - Intronic
1036409785 8:8488869-8488891 TTGCATGGGTAGAGGGAGTGAGG - Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1039108943 8:34020699-34020721 TTACATGGGTGGTGGGAACAGGG - Intergenic
1040983127 8:53266264-53266286 CTGCATGGGTGTGGGGAGTGGGG - Intergenic
1041102663 8:54412308-54412330 CTGCAGGTGAGGAGGAAGCATGG - Intergenic
1041430681 8:57777838-57777860 CTGCATGGGTGGAGCCCACATGG + Intergenic
1041599905 8:59704766-59704788 CTGCATGGCTGGAGAGGGCTAGG + Intergenic
1042645482 8:70982027-70982049 CTGCACTGGTGGAGGTAGCAGGG + Intergenic
1043007418 8:74836805-74836827 CTGCTTGGGTGGAGTGGGGATGG + Intronic
1044629808 8:94267243-94267265 GTGGATGGATGGAGGGAGCCTGG - Intergenic
1045866210 8:106868493-106868515 CTGCATGTGTGCAGGGAGAAGGG - Intergenic
1046618854 8:116506663-116506685 CTTCATGGGTGGTGGGGGAAGGG - Intergenic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1047711660 8:127558792-127558814 CTGCACGGGTGGCGGCAGCGTGG + Intergenic
1047798059 8:128278065-128278087 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1047845497 8:128801214-128801236 ATGCATGGGTGGAGGGGGTGGGG + Intergenic
1047996439 8:130341199-130341221 CTGGATGGGTGCAGGGCGCCAGG + Intronic
1048299396 8:133240098-133240120 CAGCAGCGTTGGAGGGAGCAAGG + Intronic
1049253302 8:141600828-141600850 CTGCATGTGTAGAGGGTGCCTGG - Intergenic
1049258890 8:141628240-141628262 CTGGAGGGGTGGAGGCTGCAGGG + Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049447110 8:142636252-142636274 CTGCCTAGGTGGGGGGACCAAGG - Intergenic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049791839 8:144475786-144475808 CTGGCCGGGTGGAGGGTGCAGGG + Exonic
1050121575 9:2313966-2313988 CTGCAGGGGTGGAGCGTTCATGG + Intergenic
1050189755 9:3012442-3012464 CTGCCAGGGTTGAGGGAGGAAGG - Intergenic
1051086002 9:13349748-13349770 CTGCATGTGTGGGGGGGACAGGG - Intergenic
1051885613 9:21889779-21889801 CTGCTTCAGTGGAGGTAGCAGGG + Intronic
1052178990 9:25502033-25502055 CTGCATGGGTGGAGCTTTCATGG + Intergenic
1052359572 9:27539659-27539681 TGGCATGAGTGGAGGGAGAAGGG - Intergenic
1053075190 9:35127122-35127144 CTGAAAGGCTGAAGGGAGCAAGG - Intergenic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1055027362 9:71736353-71736375 CTGCATCAGTGAAGGTAGCAGGG + Intronic
1055137966 9:72844637-72844659 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1055828940 9:80358320-80358342 CTGCAGGTGGGGAGGTAGCAGGG + Intergenic
1056826100 9:89877373-89877395 CTGCAATGGTGCATGGAGCAGGG - Intergenic
1056893043 9:90514008-90514030 GTGGATGGCTGGAGGGTGCAGGG - Intergenic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1056948119 9:91018067-91018089 CTGCTCTGGTGGAGGCAGCAGGG - Intergenic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1057172554 9:92971933-92971955 GTGGATGGGTGGAGGGGGCTGGG - Intronic
1057212753 9:93209640-93209662 GTGCTTGGGTGGAAGGAACAAGG + Intronic
1057475772 9:95399754-95399776 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1057510896 9:95678726-95678748 GAGAATGGGTGCAGGGAGCAGGG + Intergenic
1057820936 9:98330106-98330128 ATGCAGGGCTGGAGGGAGCTTGG - Intronic
1057873313 9:98734062-98734084 GGGCATGTGTGGAGGCAGCACGG - Exonic
1059045488 9:110861830-110861852 CTGCATGGGTGGAGCCCTCATGG + Intergenic
1060105524 9:120870424-120870446 CTGGGTGAGTGGAGCGAGCAGGG - Exonic
1060484787 9:124040188-124040210 ATGCAGGGCTGGAGGGGGCAGGG + Intergenic
1061251027 9:129426461-129426483 CTGCACCTGTGGAGTGAGCAAGG - Intergenic
1061546931 9:131309793-131309815 GGGAATGGGTGGAGGGAGCCAGG + Intergenic
1061651556 9:132054522-132054544 CTGCTTGGGAGGCGGGAGGATGG - Intronic
1061751530 9:132780927-132780949 CTGCAAGGAGGGAGGGGGCAGGG - Intronic
1062050062 9:134442596-134442618 CTGCCTGGCTGGTGGGAGCACGG - Intergenic
1062307816 9:135919646-135919668 CAGCATGGGTGGAGTGAGGAGGG - Intergenic
1062459116 9:136655500-136655522 TGGCAGGGCTGGAGGGAGCACGG + Intergenic
1062584639 9:137243781-137243803 CTGCATGGCTGCGGGGAGCCAGG + Exonic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1186002067 X:5023797-5023819 ATGGATGGGTGGATGGATCAGGG - Intergenic
1186457997 X:9725754-9725776 CTCCATGGGTTGGGAGAGCAGGG + Exonic
1187027294 X:15448790-15448812 CTGCTTGTGTGGATGGAGCAAGG - Intronic
1187109231 X:16279014-16279036 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1188979891 X:36717479-36717501 ATGTATTGTTGGAGGGAGCATGG + Intergenic
1188985979 X:36768725-36768747 CTTCATGTGTGGATGGTGCATGG - Intergenic
1189376019 X:40466879-40466901 CTGCCGGGGAGGTGGGAGCAAGG + Intergenic
1189567254 X:42255402-42255424 CTGCTTCAGTGGAGGCAGCAGGG - Intergenic
1189946028 X:46179999-46180021 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1190061413 X:47214240-47214262 CTGCATGGGGGTAGGGGGGATGG + Intronic
1190282572 X:48940669-48940691 CCACATGGAGGGAGGGAGCAAGG + Intronic
1190387617 X:49898180-49898202 CTGCAGGGGTGGAGTGCTCATGG + Intergenic
1190731704 X:53230871-53230893 CTGGAGGGGTGGAGGGAGTGAGG + Intergenic
1190886047 X:54531513-54531535 CTGCATGGGTGGTGTGTGGAGGG - Intronic
1191026574 X:55920019-55920041 CTGCTCTGGTGGAGGTAGCAGGG - Intergenic
1191738906 X:64416824-64416846 CTGCATAGGTGGTGGCAGAAAGG + Intergenic
1193203142 X:78715648-78715670 CTCCTTTGGTGGAGGTAGCAGGG - Intergenic
1193541825 X:82781941-82781963 CTGCAGGGGTGGAGGCTTCATGG - Intergenic
1193678214 X:84483295-84483317 CTGCATGGGTGGAGCCCTCATGG - Intronic
1193994854 X:88352915-88352937 CTGCTCCGGTGGAGGAAGCAGGG - Intergenic
1194237251 X:91399534-91399556 CTGCTTGGGTGGAGGTGGCAGGG - Intergenic
1194283750 X:91984733-91984755 CTGGATGGGGGGCGGGAGAAAGG - Intronic
1194328889 X:92556827-92556849 CTGCATGGGTGGAGCCCTCATGG - Intronic
1194801310 X:98276838-98276860 CTGGATGGGGGGAGGAAGGAGGG + Intergenic
1194881767 X:99261101-99261123 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1194982337 X:100453350-100453372 CTGCAGGGGTGGAGCCATCATGG + Intergenic
1195416442 X:104625173-104625195 ATGCATGGATGGATGGAGGATGG - Intronic
1196024073 X:111021292-111021314 CTGCTCTGGTGGAGGTAGCAGGG - Intronic
1196977857 X:121179896-121179918 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1197649726 X:129051620-129051642 CTGCATGGCTGGGGAGAGCTCGG + Intergenic
1198573712 X:137987088-137987110 CAGCATGGGTGCAGGATGCAGGG - Intergenic
1198943234 X:141981925-141981947 CTGCTCTGGTGGAGGTAGCAGGG + Intergenic
1199282881 X:146022568-146022590 CTGCTTTGGTGGAGGTGGCAGGG - Intergenic
1199415725 X:147580844-147580866 CTATATGGGGGGAGGGAGCGAGG + Intergenic
1199424256 X:147682411-147682433 CTGCTTTGGTGGAGGCAGCAGGG - Intergenic
1199871474 X:151902292-151902314 CTGCAGGGGTGGAGAGAGGCTGG + Intergenic
1200213418 X:154356885-154356907 CTGCGTGGGCTGAGGGAACAAGG - Intronic
1200601322 Y:5209297-5209319 CTGGATGGGGGGCGGGAGAAGGG - Intronic
1200637595 Y:5676029-5676051 CTGCATGGGTGGAGCCCTCATGG - Intronic