ID: 973826602

View in Genome Browser
Species Human (GRCh38)
Location 4:54713319-54713341
Sequence ACCTCACGAGCTAAGCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973826602 Original CRISPR ACCTCACGAGCTAAGCAATG AGG (reversed) Intronic
901094492 1:6667300-6667322 ACCTAACCACCTAAGCATTGAGG - Intronic
902283732 1:15392895-15392917 ACCTACCGTGCTAAGCACTGGGG + Intronic
907046721 1:51304072-51304094 ACCCCACGAGCAAAGGACTGGGG - Intronic
911901915 1:103517178-103517200 GCCTGAAGAGCTAAGCTATGTGG - Intergenic
1069912004 10:71765536-71765558 CCCTCAGGGTCTAAGCAATGGGG + Intronic
1072187278 10:93052025-93052047 ACCTCAAGAGAAAAGCAATTGGG - Intronic
1075173350 10:120136455-120136477 ACCTTACTGGGTAAGCAATGTGG + Intergenic
1081225567 11:40517986-40518008 ACCTGACAAAATAAGCAATGGGG + Intronic
1084267516 11:68012584-68012606 ACCCCACAACCTAAGCAGTGTGG + Intronic
1086293967 11:85344270-85344292 AGCTCAGGAGCTAAGAACTGGGG - Intronic
1089750507 11:120648102-120648124 ACCTCCCTAGCTAAGCAAGTGGG - Intronic
1095930308 12:47619003-47619025 TCCTCACGTGCTATACAATGTGG + Intergenic
1097016294 12:55989717-55989739 ATGTCACTAGCTAAGGAATGGGG - Intronic
1102386749 12:112516460-112516482 GCGTCACAAGCTAAGGAATGTGG - Intergenic
1128707124 15:69844423-69844445 ACCTCACAAGATAAGCAAGCAGG + Intergenic
1134188552 16:12103418-12103440 ACCTGACAAAATAAGCAATGGGG + Intronic
1140558767 16:75952923-75952945 TCTTCCTGAGCTAAGCAATGTGG - Intergenic
1140704464 16:77613734-77613756 AGGTCAAGAGCTAAGGAATGTGG - Intergenic
1152347764 17:79763986-79764008 CCGCCACGAGCGAAGCAATGTGG + Intergenic
1154043732 18:10884569-10884591 AGCTCACTAGCCAGGCAATGTGG - Intronic
1158228625 18:55228809-55228831 TCCTCACGAGCTCTGCAAGGAGG + Intronic
1164086979 19:21911920-21911942 ATCTCAGGAGTTAGGCAATGGGG - Intergenic
932539689 2:72639110-72639132 ACACCACCAGCAAAGCAATGTGG - Intronic
940539870 2:154999380-154999402 AGCTCACAAGGTCAGCAATGAGG + Intergenic
948679897 2:239626654-239626676 GCCTCAGGAGCTCAGCAGTGCGG - Intergenic
1178258376 21:31075999-31076021 AGCTCTCAAGCTAAGCTATGAGG + Intergenic
1183078675 22:35442567-35442589 AGGCCCCGAGCTAAGCAATGTGG - Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960368568 3:116806114-116806136 ACCTGAAGAGCAAAACAATGAGG + Intronic
961583859 3:127905884-127905906 ACCTGACAAAATAAGCAATGGGG + Intergenic
962575104 3:136749211-136749233 AGCTCACCAGCTAAGCTCTGAGG - Intronic
962845342 3:139269161-139269183 AATTCACGAGCAAAGCCATGTGG + Intronic
963353952 3:144186957-144186979 ATCTCAGAAGCTAAGCAATCTGG - Intergenic
971309212 4:25510024-25510046 ACCTAATGGGCTAAGCAATAAGG + Intergenic
973826602 4:54713319-54713341 ACCTCACGAGCTAAGCAATGAGG - Intronic
980474338 4:133292147-133292169 TCCTCATGAGCTAAGCATTATGG - Intergenic
983870663 4:172821917-172821939 GCCTCCAGAGCCAAGCAATGGGG - Intronic
986247620 5:6025117-6025139 ACCTCAGGAGAGAGGCAATGCGG + Intergenic
999067248 5:148701682-148701704 ACATCAGAAGCTAAGCACTGTGG + Intergenic
1016469995 6:144365116-144365138 AAATCAAGAGCTACGCAATGTGG - Intronic
1018284857 6:162226431-162226453 TCCTCACGAGCAGAGCCATGTGG + Intronic
1018297830 6:162368127-162368149 TCCTCCCGAGCCAAGCATTGCGG + Intronic
1022676128 7:32500871-32500893 ACCTGACAAAATAAGCAATGGGG - Intronic
1024233359 7:47379462-47379484 AATTCAAGAGCTAAGAAATGAGG + Intronic
1024401169 7:48926217-48926239 ACCTAAGAAGCTAATCAATGGGG + Intergenic
1024424191 7:49206908-49206930 ACCACACAACCTAAGCAATGAGG + Intergenic
1025854322 7:65264665-65264687 ATCTCACCAGAGAAGCAATGGGG + Intergenic
1034338003 7:150335758-150335780 ACCTCAAGATTTAAGCAGTGAGG - Intronic
1035113130 7:156501136-156501158 ACCTGACAAAATAAGCAATGGGG - Intergenic
1037660030 8:20918448-20918470 AACTCAGGAGCTAGGAAATGTGG + Intergenic
1042760646 8:72268283-72268305 ACCTGAAGAGCAAAGCAATTGGG + Intergenic
1042990990 8:74639617-74639639 ATATCATGGGCTAAGCAATGAGG - Intronic
1044825428 8:96191775-96191797 ACCTGACAAAATAAGCAATGGGG - Intergenic
1060190406 9:121588862-121588884 CCCCCAAGAGCTAAGCACTGAGG + Intronic
1193763871 X:85501512-85501534 ACGTCATGAGCTAAACATTGTGG + Intergenic
1194027872 X:88776448-88776470 ACCTGACAAAATAAGCAATGGGG - Intergenic
1202021387 Y:20468260-20468282 ACCACAGGACCTAATCAATGGGG + Intergenic
1202086283 Y:21140149-21140171 AGCAGAGGAGCTAAGCAATGGGG - Intergenic
1202190598 Y:22239783-22239805 ACCTTACAAGCAAAGCAATGTGG - Intergenic
1202266851 Y:23028622-23028644 ACCGCATGAGCTAAGCATTACGG + Intergenic
1202419844 Y:24662367-24662389 ACCGCATGAGCTAAGCATTACGG + Intergenic
1202450942 Y:25007717-25007739 ACCGCATGAGCTAAGCATTACGG - Intergenic