ID: 973828065

View in Genome Browser
Species Human (GRCh38)
Location 4:54729258-54729280
Sequence GCCTCCCATAAAAATACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973828065 Original CRISPR GCCTCCCATAAAAATACCCA AGG (reversed) Intronic
904489942 1:30852344-30852366 GCCTCCCATAACCCTGCCCAGGG - Intergenic
904723037 1:32525086-32525108 GCCTCTCTTCCAAATACCCAAGG + Intronic
908226761 1:62063740-62063762 GCCACACAAAAAAATACCTAGGG - Intronic
909566283 1:77056882-77056904 TCCTCCCATAAGAAGATCCAAGG + Intronic
910121801 1:83798432-83798454 GCCTCCCATACACATCCTCATGG - Intergenic
910159274 1:84256228-84256250 GCCCCCCACAAAAATGTCCATGG + Intergenic
910809745 1:91224206-91224228 GCCTCCCATAAATATTTACAGGG + Intergenic
919344960 1:196363403-196363425 TCCTCCAATATAAATATCCAGGG - Intronic
1064426070 10:15230589-15230611 AACTACCCTAAAAATACCCAGGG - Intronic
1066222387 10:33347818-33347840 GCCCCTCTTAAAAATAACCAGGG - Intergenic
1069639535 10:69945766-69945788 GCCCCCATTAGAAATACCCACGG + Intronic
1070386943 10:75934372-75934394 CTCTCCCATAAAGACACCCAAGG - Intronic
1076459674 10:130633083-130633105 GCCTCTCAGAAATATCCCCATGG + Intergenic
1078047726 11:7932187-7932209 GCCTCCCATATTAGTCCCCATGG + Intergenic
1078858706 11:15227700-15227722 GCCTACCATAGACATACCCTTGG + Intronic
1080011899 11:27468538-27468560 TCCTCTCATAAAAATATCCCAGG - Intronic
1080799889 11:35600620-35600642 GCCTCCCACACAAATCCTCAGGG - Intergenic
1081445099 11:43123621-43123643 ACCTCCATTAAACATACCCAAGG + Intergenic
1083189273 11:61037686-61037708 GGTTCCCATCAAACTACCCATGG + Intergenic
1084580405 11:70019737-70019759 GCCTGCCCTAGAATTACCCAAGG - Intergenic
1085021364 11:73211689-73211711 ATCTCCCTTAAAAATATCCATGG + Intergenic
1086641717 11:89166855-89166877 CAATCCCATAAAAATACCAATGG + Intergenic
1086883566 11:92177359-92177381 GCCTCTCTTACAACTACCCATGG - Intergenic
1087284757 11:96253066-96253088 CCCTCGCACAGAAATACCCAAGG + Intronic
1092084301 12:5743019-5743041 GCCACCAATAAAAATTTCCAGGG - Intronic
1093052337 12:14517640-14517662 GCCTTCCATAAAAAGCCTCAAGG - Intronic
1096088759 12:48884077-48884099 GCCTTCCATAAACATTCCAAAGG - Intergenic
1096374375 12:51096124-51096146 GCCTCCCATATAAATCCCTCTGG - Intronic
1096586584 12:52626571-52626593 GCCTCCCTTGAAAATAACTATGG - Intergenic
1097190580 12:57217553-57217575 GCCTCCCATCACATTTCCCACGG + Intronic
1099821572 12:87717714-87717736 CTCTCCAATAAAAATAACCAGGG + Intergenic
1101173586 12:102125474-102125496 CCTTCCCATAAAAATCCCCATGG - Intronic
1102201582 12:111061065-111061087 GCCTCCCATGAACAGCCCCAAGG - Intronic
1106355415 13:28977443-28977465 GTCTCCCATAAAAATATAAAAGG - Intronic
1110936789 13:81300590-81300612 ACCTCACATTAAAATGCCCAAGG + Intergenic
1111594714 13:90396697-90396719 GCCTCCCATAAAGATTTACAGGG + Intergenic
1113834627 13:113320532-113320554 GCCTCCCATGAGCAGACCCAGGG - Intronic
1115437510 14:33392205-33392227 GCCGCCCTTAAAATTACCCCTGG + Intronic
1115852577 14:37599450-37599472 GCAACGCATAAACATACCCAGGG + Intronic
1116332879 14:43617089-43617111 GCCTTCCATAAAAATTTACAGGG + Intergenic
1116983694 14:51196981-51197003 GCCTCCCAGAGAAATAGCAATGG - Intergenic
1118610839 14:67538495-67538517 ACCTCCCATAAAAATGCACAAGG - Intronic
1119873775 14:78038835-78038857 TCCTCACTTATAAATACCCAGGG + Intergenic
1121532263 14:94663348-94663370 GGCTGCCATAAAAAGCCCCATGG - Intergenic
1122352137 14:101102530-101102552 GACTCCCTTAAAAATAGCCAAGG - Intergenic
1128377767 15:67089583-67089605 GCCTCAGAAAAAAATGCCCATGG + Intronic
1128815486 15:70605171-70605193 ATTTCCCATAAAAATACCAAGGG - Intergenic
1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG + Intronic
1134899131 16:17919055-17919077 GCCTAGCATAAGAATAGCCAAGG + Intergenic
1135993282 16:27230309-27230331 GCTTCCCACAGAAATAGCCAGGG - Intronic
1136285382 16:29237490-29237512 GCCTCCCCTAGACATAACCAAGG + Intergenic
1137805290 16:51298939-51298961 GCTTCCAATCAATATACCCATGG + Intergenic
1139327329 16:66162590-66162612 GCCTCACATAAAAGTACCTTGGG + Intergenic
1141244375 16:82292560-82292582 GCCTCCAATTTAAAAACCCAGGG - Intergenic
1141907868 16:87039618-87039640 GCCTCCAATAATAAGACCCACGG + Intergenic
1142090707 16:88207622-88207644 GCCTCCCCTAGACATAACCAAGG + Intergenic
1142203703 16:88772923-88772945 GCCTCCCCTCCAAACACCCACGG + Intronic
1142943395 17:3402834-3402856 GCTTCCCATAAAAATACCCCAGG + Intergenic
1144774308 17:17777339-17777361 GCTTCCCTTACAAATACTCAAGG + Intronic
1150027060 17:61687857-61687879 GCCTCCCAGAAAAAGACATAAGG - Intronic
1152578857 17:81157211-81157233 GCCTCTCCTAAAAATAACCGTGG - Intronic
1157932312 18:51836479-51836501 GCCTGCCACAAAAGTACCTAAGG + Intergenic
1158988435 18:62843540-62843562 GCTTACCAAAATAATACCCAAGG + Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160842755 19:1153982-1154004 GCCTCCCATTCACATCCCCATGG + Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1164369760 19:27634377-27634399 CTCTCCCATTAAAATACCAAAGG + Intergenic
1164371305 19:27646705-27646727 GTCTCCCATAAAAATGCCTAGGG + Intergenic
1164374713 19:27674772-27674794 TCCTCCCATTAAAATTCCCGGGG + Intergenic
1164380592 19:27734258-27734280 CTCTCCCATAAAAATACCTGTGG + Intergenic
1166647901 19:44546115-44546137 GCCTCCCAGAAAAAGCCACAGGG - Intergenic
925868165 2:8246919-8246941 CCCACCCATAAAACTACACATGG - Intergenic
927372765 2:22376267-22376289 AACTCCCATAAAATTACTCAAGG + Intergenic
927617270 2:24611799-24611821 CCCGCACATAACAATACCCACGG - Intronic
929554745 2:42919065-42919087 GCCTCCCCAAGAACTACCCAGGG - Intergenic
935966545 2:108482848-108482870 GTCTCCACTAAAAATACACACGG - Intronic
938138111 2:128775530-128775552 GCACCTCATAAAAAGACCCAGGG + Intergenic
939072626 2:137561301-137561323 CCCTCCCATATAAAGCCCCAAGG - Intronic
941066233 2:160906062-160906084 GCCTCCCATAAAAGCAGGCAAGG + Intergenic
941535524 2:166718455-166718477 GACCCCCATAAAAATCCCAATGG - Intergenic
944583254 2:201151425-201151447 TCTTCCCATAAAACTCCCCATGG - Intronic
1168791761 20:582336-582358 TCCCCCCATAAAAATACCAGGGG - Intergenic
1177031897 21:15990856-15990878 GCCTCAAATAAAAATATCCAAGG + Intergenic
1178102832 21:29288554-29288576 GCAGCTCATAAAAATACTCATGG - Intronic
955777237 3:62446981-62447003 GTCTCCCAGAAAAGTACCCAGGG + Intronic
955800815 3:62684446-62684468 TTCTCCCATAAAAAGAGCCAGGG - Intronic
958120971 3:89287605-89287627 ACCTCCCACCAAAATACCCAGGG + Intronic
961088179 3:124088124-124088146 GCCTCACATCATGATACCCATGG - Intronic
962663774 3:137633055-137633077 GCCTCCCATTAGAATCCCCTAGG + Intergenic
962955392 3:140261539-140261561 GTCTCCAATAAAAAGAACCAGGG - Intronic
971400255 4:26269559-26269581 GCCACACATTAAAATAACCAAGG - Intronic
972876923 4:43374072-43374094 GCCTACCCGGAAAATACCCATGG + Intergenic
973828065 4:54729258-54729280 GCCTCCCATAAAAATACCCAAGG - Intronic
976751230 4:88452918-88452940 GCCTCCCATAAAGATTTCTAGGG + Intergenic
977964746 4:103131970-103131992 TCCTGCCATAAAAATTCCCTGGG - Intronic
978432601 4:108649488-108649510 GCATCCTGTAAAAATAACCACGG + Intergenic
979200290 4:117969634-117969656 ACTTCCAATAAAAATACACAAGG + Intergenic
979582952 4:122381050-122381072 TCCTCCAAAAAAAATACCTAAGG + Exonic
979626864 4:122854795-122854817 GACTCCCATGAAAATAGCCCCGG - Intronic
982294294 4:153810812-153810834 GTCTCACATTAAAATACACATGG - Intergenic
984159895 4:176239097-176239119 GCCACCCATACAAATAGCCTGGG - Intronic
984610523 4:181832092-181832114 TCCTCCCATATAATTACCTATGG - Intergenic
984663701 4:182402498-182402520 GCCAGCCATAAAAATAAACATGG + Intronic
986589874 5:9357543-9357565 TACTCCATTAAAAATACCCAGGG + Intronic
986597496 5:9439007-9439029 GCTTCCCATGAACATACCAAAGG - Intronic
987461189 5:18212763-18212785 GCCTCCCAAAAATAACCCCAAGG - Intergenic
989485851 5:41991165-41991187 GCCTCCCATGATGATACCCTGGG + Intergenic
993364425 5:87019093-87019115 ACCTCCCATAAGAATAGCCAAGG + Intergenic
993529888 5:89011195-89011217 GCCTTTCAAAAAAATATCCATGG - Intergenic
996192430 5:120562359-120562381 TTCTCCTATAAAAATACACATGG - Intronic
998036567 5:138922053-138922075 GCATGCCATAAAGATACCCAGGG + Intronic
999982217 5:156968441-156968463 TCCTCCCATAAAAAGAACCAGGG + Intergenic
1003411582 6:5868181-5868203 ACCACACATAAAAATACCAAGGG + Intergenic
1003591275 6:7438947-7438969 GCCTACCATAATGATAGCCAGGG + Intergenic
1007314130 6:40970809-40970831 GCCTCACATAATAGCACCCAAGG - Intergenic
1007767706 6:44170820-44170842 GGCTCCCATAGAAAGCCCCAGGG + Intronic
1008614709 6:53215171-53215193 CCCTCCCCTACAAATACCTAGGG - Intergenic
1010984206 6:82403527-82403549 TCATCCCATAAAAATAACCCTGG - Intergenic
1011832797 6:91393675-91393697 CCCATCCATTAAAATACCCAAGG + Intergenic
1012854665 6:104487843-104487865 GCCTGTCATAAAATTACACAAGG - Intergenic
1014666468 6:124243625-124243647 GCCTTCCATAAATGTACCTATGG + Intronic
1017434199 6:154400455-154400477 CCCTTCCATAGAAATACACATGG - Exonic
1019053398 6:169201780-169201802 GCCTCCCCTAAATTTTCCCAGGG - Intergenic
1021685201 7:23178828-23178850 ACATCCCAGAAAAATACCTATGG - Intergenic
1022964637 7:35461354-35461376 GGCTCCCATTAAAAGAGCCATGG - Intergenic
1029708799 7:102288594-102288616 GACTTCTATACAAATACCCAGGG + Intronic
1029999826 7:105047910-105047932 TCCTACCATAAACATTCCCAAGG + Intronic
1034045443 7:147922456-147922478 GTCTTCCATAAAAATACTGAGGG + Intronic
1040866139 8:52050676-52050698 GCCTCCCACAGTAATAGCCAAGG + Intergenic
1041274599 8:56143704-56143726 GCCTTCCCTAAAAAGACCTATGG - Intergenic
1042389926 8:68222245-68222267 TTCTCCAATAAAAATAGCCAGGG + Intronic
1042976934 8:74479802-74479824 GCCTGCCATATAAAAACCCCAGG - Intronic
1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG + Intronic
1053093510 9:35302816-35302838 ACTTCCAAGAAAAATACCCAAGG + Intronic
1056475637 9:86948525-86948547 GCCTCCCTTAAATATACTGAGGG - Intergenic
1056525144 9:87436323-87436345 GCATCCCATTAAAATAACCGTGG - Intergenic
1057745695 9:97749152-97749174 TCCTCCCACAAAAAACCCCATGG + Intergenic
1060216308 9:121740498-121740520 GCCTTCCAGAGAAATACCCTTGG - Intronic
1061509965 9:131054376-131054398 GCCTCCCAAAACATTACCCATGG - Intronic
1062480482 9:136748605-136748627 GCCTCCTGCAAAATTACCCAGGG + Intergenic
1185950253 X:4424403-4424425 GCCTTCCATAAACATACTAAGGG + Intergenic
1189076668 X:37922782-37922804 GACACACGTAAAAATACCCAGGG - Intronic
1190095050 X:47472690-47472712 GCCTCCCAAAGAAAGACACATGG + Intronic
1190753952 X:53384590-53384612 GCATCACAAAAAAATAGCCAGGG + Intronic
1193370682 X:80694013-80694035 CCCTCCCATCACAAGACCCAGGG + Intronic
1194487291 X:94500661-94500683 GCTTACCATAAAAATATCCAGGG - Intergenic
1196296393 X:114002231-114002253 GCCTTCCATAAAAATAGACTTGG - Intergenic
1197884049 X:131199657-131199679 GCCACCCATTAAAATACTAATGG + Intergenic
1198564430 X:137889791-137889813 GCCTTCCATAAAGATTCACATGG + Intergenic
1201231448 Y:11868605-11868627 GCATCACAATAAAATACCCAAGG - Intergenic