ID: 973829728

View in Genome Browser
Species Human (GRCh38)
Location 4:54746591-54746613
Sequence CACCCAGGTGGCCTGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973829728_973829733 4 Left 973829728 4:54746591-54746613 CCACACAACAGGCCACCTGGGTG No data
Right 973829733 4:54746618-54746640 GAGTGCCAAACCCTCTTATATGG No data
973829728_973829737 25 Left 973829728 4:54746591-54746613 CCACACAACAGGCCACCTGGGTG No data
Right 973829737 4:54746639-54746661 GGCATAATTTGCTTCTAATCAGG No data
973829728_973829738 26 Left 973829728 4:54746591-54746613 CCACACAACAGGCCACCTGGGTG No data
Right 973829738 4:54746640-54746662 GCATAATTTGCTTCTAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973829728 Original CRISPR CACCCAGGTGGCCTGTTGTG TGG (reversed) Intergenic
No off target data available for this crispr