ID: 973829729 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:54746592-54746614 |
| Sequence | CACACAACAGGCCACCTGGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973829724_973829729 | 4 | Left | 973829724 | 4:54746565-54746587 | CCTAGGGAAACTGAAAACACTTG | No data | ||
| Right | 973829729 | 4:54746592-54746614 | CACACAACAGGCCACCTGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973829729 | Original CRISPR | CACACAACAGGCCACCTGGG TGG | Intergenic | ||