ID: 973829730

View in Genome Browser
Species Human (GRCh38)
Location 4:54746603-54746625
Sequence TGGCACTCAGGCCACCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973829730_973829737 13 Left 973829730 4:54746603-54746625 CCACCTGGGTGGCCTGAGTGCCA No data
Right 973829737 4:54746639-54746661 GGCATAATTTGCTTCTAATCAGG No data
973829730_973829733 -8 Left 973829730 4:54746603-54746625 CCACCTGGGTGGCCTGAGTGCCA No data
Right 973829733 4:54746618-54746640 GAGTGCCAAACCCTCTTATATGG No data
973829730_973829738 14 Left 973829730 4:54746603-54746625 CCACCTGGGTGGCCTGAGTGCCA No data
Right 973829738 4:54746640-54746662 GCATAATTTGCTTCTAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973829730 Original CRISPR TGGCACTCAGGCCACCCAGG TGG (reversed) Intergenic