ID: 973829731

View in Genome Browser
Species Human (GRCh38)
Location 4:54746606-54746628
Sequence GTTTGGCACTCAGGCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973829731_973829739 29 Left 973829731 4:54746606-54746628 CCTGGGTGGCCTGAGTGCCAAAC No data
Right 973829739 4:54746658-54746680 CAGGGTGCATTTTACTCCTATGG No data
973829731_973829738 11 Left 973829731 4:54746606-54746628 CCTGGGTGGCCTGAGTGCCAAAC No data
Right 973829738 4:54746640-54746662 GCATAATTTGCTTCTAATCAGGG No data
973829731_973829737 10 Left 973829731 4:54746606-54746628 CCTGGGTGGCCTGAGTGCCAAAC No data
Right 973829737 4:54746639-54746661 GGCATAATTTGCTTCTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973829731 Original CRISPR GTTTGGCACTCAGGCCACCC AGG (reversed) Intergenic
No off target data available for this crispr