ID: 973829732

View in Genome Browser
Species Human (GRCh38)
Location 4:54746615-54746637
Sequence TATAAGAGGGTTTGGCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973829732_973829740 29 Left 973829732 4:54746615-54746637 CCTGAGTGCCAAACCCTCTTATA No data
Right 973829740 4:54746667-54746689 TTTTACTCCTATGGAGTGTTTGG No data
973829732_973829738 2 Left 973829732 4:54746615-54746637 CCTGAGTGCCAAACCCTCTTATA No data
Right 973829738 4:54746640-54746662 GCATAATTTGCTTCTAATCAGGG No data
973829732_973829739 20 Left 973829732 4:54746615-54746637 CCTGAGTGCCAAACCCTCTTATA No data
Right 973829739 4:54746658-54746680 CAGGGTGCATTTTACTCCTATGG No data
973829732_973829737 1 Left 973829732 4:54746615-54746637 CCTGAGTGCCAAACCCTCTTATA No data
Right 973829737 4:54746639-54746661 GGCATAATTTGCTTCTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973829732 Original CRISPR TATAAGAGGGTTTGGCACTC AGG (reversed) Intergenic