ID: 973829733

View in Genome Browser
Species Human (GRCh38)
Location 4:54746618-54746640
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973829724_973829733 30 Left 973829724 4:54746565-54746587 CCTAGGGAAACTGAAAACACTTG No data
Right 973829733 4:54746618-54746640 GAGTGCCAAACCCTCTTATATGG No data
973829730_973829733 -8 Left 973829730 4:54746603-54746625 CCACCTGGGTGGCCTGAGTGCCA No data
Right 973829733 4:54746618-54746640 GAGTGCCAAACCCTCTTATATGG No data
973829728_973829733 4 Left 973829728 4:54746591-54746613 CCACACAACAGGCCACCTGGGTG No data
Right 973829733 4:54746618-54746640 GAGTGCCAAACCCTCTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type