ID: 973829738

View in Genome Browser
Species Human (GRCh38)
Location 4:54746640-54746662
Sequence GCATAATTTGCTTCTAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973829728_973829738 26 Left 973829728 4:54746591-54746613 CCACACAACAGGCCACCTGGGTG No data
Right 973829738 4:54746640-54746662 GCATAATTTGCTTCTAATCAGGG No data
973829732_973829738 2 Left 973829732 4:54746615-54746637 CCTGAGTGCCAAACCCTCTTATA No data
Right 973829738 4:54746640-54746662 GCATAATTTGCTTCTAATCAGGG No data
973829734_973829738 -6 Left 973829734 4:54746623-54746645 CCAAACCCTCTTATATGGCATAA No data
Right 973829738 4:54746640-54746662 GCATAATTTGCTTCTAATCAGGG No data
973829731_973829738 11 Left 973829731 4:54746606-54746628 CCTGGGTGGCCTGAGTGCCAAAC No data
Right 973829738 4:54746640-54746662 GCATAATTTGCTTCTAATCAGGG No data
973829730_973829738 14 Left 973829730 4:54746603-54746625 CCACCTGGGTGGCCTGAGTGCCA No data
Right 973829738 4:54746640-54746662 GCATAATTTGCTTCTAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973829738 Original CRISPR GCATAATTTGCTTCTAATCA GGG Intergenic
No off target data available for this crispr