ID: 973829739

View in Genome Browser
Species Human (GRCh38)
Location 4:54746658-54746680
Sequence CAGGGTGCATTTTACTCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973829732_973829739 20 Left 973829732 4:54746615-54746637 CCTGAGTGCCAAACCCTCTTATA No data
Right 973829739 4:54746658-54746680 CAGGGTGCATTTTACTCCTATGG No data
973829735_973829739 7 Left 973829735 4:54746628-54746650 CCCTCTTATATGGCATAATTTGC No data
Right 973829739 4:54746658-54746680 CAGGGTGCATTTTACTCCTATGG No data
973829731_973829739 29 Left 973829731 4:54746606-54746628 CCTGGGTGGCCTGAGTGCCAAAC No data
Right 973829739 4:54746658-54746680 CAGGGTGCATTTTACTCCTATGG No data
973829736_973829739 6 Left 973829736 4:54746629-54746651 CCTCTTATATGGCATAATTTGCT No data
Right 973829739 4:54746658-54746680 CAGGGTGCATTTTACTCCTATGG No data
973829734_973829739 12 Left 973829734 4:54746623-54746645 CCAAACCCTCTTATATGGCATAA No data
Right 973829739 4:54746658-54746680 CAGGGTGCATTTTACTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973829739 Original CRISPR CAGGGTGCATTTTACTCCTA TGG Intergenic