ID: 973830890

View in Genome Browser
Species Human (GRCh38)
Location 4:54757617-54757639
Sequence ATTAGGATTCTGGATAACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973830886_973830890 -5 Left 973830886 4:54757599-54757621 CCCAAGGGTAGAAAGTGGATTAG No data
Right 973830890 4:54757617-54757639 ATTAGGATTCTGGATAACCTAGG No data
973830887_973830890 -6 Left 973830887 4:54757600-54757622 CCAAGGGTAGAAAGTGGATTAGG No data
Right 973830890 4:54757617-54757639 ATTAGGATTCTGGATAACCTAGG No data
973830881_973830890 21 Left 973830881 4:54757573-54757595 CCCAAAACTCAAAAGGTGGGGAA No data
Right 973830890 4:54757617-54757639 ATTAGGATTCTGGATAACCTAGG No data
973830876_973830890 27 Left 973830876 4:54757567-54757589 CCACCACCCAAAACTCAAAAGGT No data
Right 973830890 4:54757617-54757639 ATTAGGATTCTGGATAACCTAGG No data
973830878_973830890 24 Left 973830878 4:54757570-54757592 CCACCCAAAACTCAAAAGGTGGG No data
Right 973830890 4:54757617-54757639 ATTAGGATTCTGGATAACCTAGG No data
973830882_973830890 20 Left 973830882 4:54757574-54757596 CCAAAACTCAAAAGGTGGGGAAT No data
Right 973830890 4:54757617-54757639 ATTAGGATTCTGGATAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973830890 Original CRISPR ATTAGGATTCTGGATAACCT AGG Intergenic
No off target data available for this crispr