ID: 973832854

View in Genome Browser
Species Human (GRCh38)
Location 4:54779377-54779399
Sequence TTTCTCTGCACCTCAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973832854_973832859 -5 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832859 4:54779395-54779417 AGAAAGGAAAAAATGGAGGGAGG No data
973832854_973832857 -9 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832857 4:54779391-54779413 GCAGAGAAAGGAAAAAATGGAGG No data
973832854_973832858 -8 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832858 4:54779392-54779414 CAGAGAAAGGAAAAAATGGAGGG No data
973832854_973832862 10 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832862 4:54779410-54779432 GAGGGAGGAGAGATTGGTAAGGG No data
973832854_973832860 4 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832860 4:54779404-54779426 AAAATGGAGGGAGGAGAGATTGG No data
973832854_973832863 18 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832863 4:54779418-54779440 AGAGATTGGTAAGGGAGAAAAGG No data
973832854_973832865 26 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832865 4:54779426-54779448 GTAAGGGAGAAAAGGGATGAAGG No data
973832854_973832864 19 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832864 4:54779419-54779441 GAGATTGGTAAGGGAGAAAAGGG No data
973832854_973832861 9 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832861 4:54779409-54779431 GGAGGGAGGAGAGATTGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973832854 Original CRISPR TTTCTCTGCACCTCAGCTGA TGG (reversed) Intergenic
No off target data available for this crispr