ID: 973832857

View in Genome Browser
Species Human (GRCh38)
Location 4:54779391-54779413
Sequence GCAGAGAAAGGAAAAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973832854_973832857 -9 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832857 4:54779391-54779413 GCAGAGAAAGGAAAAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973832857 Original CRISPR GCAGAGAAAGGAAAAAATGG AGG Intergenic
No off target data available for this crispr