ID: 973832860

View in Genome Browser
Species Human (GRCh38)
Location 4:54779404-54779426
Sequence AAAATGGAGGGAGGAGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973832854_973832860 4 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832860 4:54779404-54779426 AAAATGGAGGGAGGAGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973832860 Original CRISPR AAAATGGAGGGAGGAGAGAT TGG Intergenic
No off target data available for this crispr