ID: 973832863

View in Genome Browser
Species Human (GRCh38)
Location 4:54779418-54779440
Sequence AGAGATTGGTAAGGGAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973832854_973832863 18 Left 973832854 4:54779377-54779399 CCATCAGCTGAGGTGCAGAGAAA No data
Right 973832863 4:54779418-54779440 AGAGATTGGTAAGGGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973832863 Original CRISPR AGAGATTGGTAAGGGAGAAA AGG Intergenic
No off target data available for this crispr