ID: 973834116

View in Genome Browser
Species Human (GRCh38)
Location 4:54792159-54792181
Sequence AGTCATAAGGCAGTGTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973834116_973834119 -9 Left 973834116 4:54792159-54792181 CCACACCACACTGCCTTATGACT No data
Right 973834119 4:54792173-54792195 CTTATGACTCTGAGTGCTGCAGG No data
973834116_973834121 27 Left 973834116 4:54792159-54792181 CCACACCACACTGCCTTATGACT No data
Right 973834121 4:54792209-54792231 AGCTGTCAAAGAAGAGTAACAGG No data
973834116_973834120 4 Left 973834116 4:54792159-54792181 CCACACCACACTGCCTTATGACT No data
Right 973834120 4:54792186-54792208 GTGCTGCAGGAATTCTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973834116 Original CRISPR AGTCATAAGGCAGTGTGGTG TGG (reversed) Intergenic
No off target data available for this crispr