ID: 973842150

View in Genome Browser
Species Human (GRCh38)
Location 4:54873322-54873344
Sequence TCACAGAAGCAGACTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973842150_973842160 22 Left 973842150 4:54873322-54873344 CCCTCCCCAGTCTGCTTCTGTGA No data
Right 973842160 4:54873367-54873389 CCCACCTCGTCAAAGAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973842150 Original CRISPR TCACAGAAGCAGACTGGGGA GGG (reversed) Intergenic
No off target data available for this crispr