ID: 973845710

View in Genome Browser
Species Human (GRCh38)
Location 4:54910951-54910973
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973845704_973845710 4 Left 973845704 4:54910924-54910946 CCAGTAATGGAAACCAGGAATTA No data
Right 973845710 4:54910951-54910973 CTCAGGCTACCAACTGATGGGGG No data
973845706_973845710 -9 Left 973845706 4:54910937-54910959 CCAGGAATTAAAGTCTCAGGCTA No data
Right 973845710 4:54910951-54910973 CTCAGGCTACCAACTGATGGGGG No data
973845703_973845710 5 Left 973845703 4:54910923-54910945 CCCAGTAATGGAAACCAGGAATT No data
Right 973845710 4:54910951-54910973 CTCAGGCTACCAACTGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type