ID: 973848480

View in Genome Browser
Species Human (GRCh38)
Location 4:54937220-54937242
Sequence GCACTCCAGCCTGGACGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973848477_973848480 -7 Left 973848477 4:54937204-54937226 CCGAGATCGCGCCATTGCACTCC 0: 5007
1: 45965
2: 123942
3: 158174
4: 108733
Right 973848480 4:54937220-54937242 GCACTCCAGCCTGGACGTGCAGG No data
973848476_973848480 19 Left 973848476 4:54937178-54937200 CCTGGGGGGGCAGAGGTTGCAGT 0: 42
1: 290
2: 1113
3: 2237
4: 3793
Right 973848480 4:54937220-54937242 GCACTCCAGCCTGGACGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973848480 Original CRISPR GCACTCCAGCCTGGACGTGC AGG Intergenic
No off target data available for this crispr