ID: 973856305

View in Genome Browser
Species Human (GRCh38)
Location 4:55013775-55013797
Sequence AAACTCTTGTGGTCATAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973856305_973856309 6 Left 973856305 4:55013775-55013797 CCACGCTATGACCACAAGAGTTT No data
Right 973856309 4:55013804-55013826 ACAGAGCCCTACCCTTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973856305 Original CRISPR AAACTCTTGTGGTCATAGCG TGG (reversed) Intergenic
No off target data available for this crispr