ID: 973857850

View in Genome Browser
Species Human (GRCh38)
Location 4:55031358-55031380
Sequence GAAGAACAGCTGTTCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973857850_973857852 2 Left 973857850 4:55031358-55031380 CCAACAGAGAACAGCTGTTCTTC No data
Right 973857852 4:55031383-55031405 CATGAGAGTCTGCTTCAGGCCGG No data
973857850_973857851 -2 Left 973857850 4:55031358-55031380 CCAACAGAGAACAGCTGTTCTTC No data
Right 973857851 4:55031379-55031401 TCAACATGAGAGTCTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973857850 Original CRISPR GAAGAACAGCTGTTCTCTGT TGG (reversed) Intergenic
No off target data available for this crispr