ID: 973858019

View in Genome Browser
Species Human (GRCh38)
Location 4:55032940-55032962
Sequence AAGGGACCTGTGAAGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973858019_973858026 14 Left 973858019 4:55032940-55032962 CCTCCAGCCTTCACAGGTCCCTT No data
Right 973858026 4:55032977-55032999 CTCTCCTGCTACATGATGCAGGG No data
973858019_973858025 13 Left 973858019 4:55032940-55032962 CCTCCAGCCTTCACAGGTCCCTT No data
Right 973858025 4:55032976-55032998 TCTCTCCTGCTACATGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973858019 Original CRISPR AAGGGACCTGTGAAGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr