ID: 973858537

View in Genome Browser
Species Human (GRCh38)
Location 4:55037526-55037548
Sequence TCCACCTTGTTTAAAAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973858535_973858537 8 Left 973858535 4:55037495-55037517 CCCACTGAAGCTTCTTAAGAGTA No data
Right 973858537 4:55037526-55037548 TCCACCTTGTTTAAAAGTTCTGG No data
973858534_973858537 15 Left 973858534 4:55037488-55037510 CCAGGATCCCACTGAAGCTTCTT No data
Right 973858537 4:55037526-55037548 TCCACCTTGTTTAAAAGTTCTGG No data
973858536_973858537 7 Left 973858536 4:55037496-55037518 CCACTGAAGCTTCTTAAGAGTAG No data
Right 973858537 4:55037526-55037548 TCCACCTTGTTTAAAAGTTCTGG No data
973858532_973858537 25 Left 973858532 4:55037478-55037500 CCTCTGACACCCAGGATCCCACT No data
Right 973858537 4:55037526-55037548 TCCACCTTGTTTAAAAGTTCTGG No data
973858533_973858537 16 Left 973858533 4:55037487-55037509 CCCAGGATCCCACTGAAGCTTCT No data
Right 973858537 4:55037526-55037548 TCCACCTTGTTTAAAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973858537 Original CRISPR TCCACCTTGTTTAAAAGTTC TGG Intergenic
No off target data available for this crispr