ID: 973859704

View in Genome Browser
Species Human (GRCh38)
Location 4:55050789-55050811
Sequence GAACACACCATGGCAAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973859704_973859708 -3 Left 973859704 4:55050789-55050811 CCTGAATTTGCCATGGTGTGTTC No data
Right 973859708 4:55050809-55050831 TTCATGGACTGTGGTCTGTTTGG No data
973859704_973859709 -2 Left 973859704 4:55050789-55050811 CCTGAATTTGCCATGGTGTGTTC No data
Right 973859709 4:55050810-55050832 TCATGGACTGTGGTCTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973859704 Original CRISPR GAACACACCATGGCAAATTC AGG (reversed) Intergenic
No off target data available for this crispr