ID: 973861509

View in Genome Browser
Species Human (GRCh38)
Location 4:55069564-55069586
Sequence GCTTTGTTCAGGGGTCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973861509_973861519 27 Left 973861509 4:55069564-55069586 CCGCCCAGACCCCTGAACAAAGC No data
Right 973861519 4:55069614-55069636 GAAGTGTTGTGTATATATTTGGG No data
973861509_973861516 -4 Left 973861509 4:55069564-55069586 CCGCCCAGACCCCTGAACAAAGC No data
Right 973861516 4:55069583-55069605 AAGCAGAAGTCTGGAGTCCACGG No data
973861509_973861518 26 Left 973861509 4:55069564-55069586 CCGCCCAGACCCCTGAACAAAGC No data
Right 973861518 4:55069613-55069635 TGAAGTGTTGTGTATATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973861509 Original CRISPR GCTTTGTTCAGGGGTCTGGG CGG (reversed) Intergenic