ID: 973863669

View in Genome Browser
Species Human (GRCh38)
Location 4:55090576-55090598
Sequence TTCCCCTGATTTCAAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973863663_973863669 28 Left 973863663 4:55090525-55090547 CCGTATGAAGCTGAAGCCAGACT 0: 1
1: 0
2: 0
3: 17
4: 198
Right 973863669 4:55090576-55090598 TTCCCCTGATTTCAAAGTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 192
973863665_973863669 12 Left 973863665 4:55090541-55090563 CCAGACTGGCTCTGATAAACAAT 0: 1
1: 0
2: 0
3: 9
4: 124
Right 973863669 4:55090576-55090598 TTCCCCTGATTTCAAAGTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973863669 Original CRISPR TTCCCCTGATTTCAAAGTGC TGG Intronic
902421694 1:16285808-16285830 GTCCCCTGATTTCCAAATGCTGG + Intronic
902440218 1:16424621-16424643 TTGCCCTGATCTCAAACTCCTGG + Intronic
904911611 1:33938446-33938468 TTCCCATGATCTCACACTGCTGG + Intronic
905004611 1:34699670-34699692 ATCCAGTGATTTCAAAGTGCTGG - Intergenic
905198087 1:36296837-36296859 CTCCTCTGATTTGAAAGTTCTGG - Intronic
905263265 1:36733893-36733915 TTCACCTGACCTCAAAGTGTTGG + Intergenic
905790715 1:40787858-40787880 TTCCCTTGAAGTCAGAGTGCTGG + Intronic
906229328 1:44147259-44147281 TTCCCCTGTTCTCATTGTGCAGG + Intergenic
906551639 1:46670641-46670663 TTCCCCTGATCTCTAAATGTAGG - Intronic
908647597 1:66295668-66295690 ATCCTCCCATTTCAAAGTGCTGG + Intronic
909123625 1:71636904-71636926 TTCCCGTGACTTCAAAGTATTGG - Intronic
909235626 1:73149392-73149414 TTCACCTGATTTCCCAGTGTTGG + Intergenic
912185486 1:107270341-107270363 TTCTCATGATGTCAAAGTTCAGG + Intronic
913056692 1:115168591-115168613 TTCCTTTGATTTCCAAATGCAGG - Intergenic
915083795 1:153370647-153370669 TTCTGCTGATTTCATAGTTCAGG + Intergenic
917473542 1:175347668-175347690 TCCGCCTGCTTCCAAAGTGCTGG + Intronic
918329187 1:183440712-183440734 TGCCCCTGATTTGACTGTGCAGG - Intergenic
918329357 1:183442625-183442647 TGCCCCTGATTTGACTGTGCAGG + Intergenic
918477948 1:184945972-184945994 ATGACCTGATTTCAAAGCGCTGG + Intronic
918730384 1:187985908-187985930 GTCCCCTGTTTTCAAATTCCTGG + Intergenic
919677155 1:200395004-200395026 TTCACCTCATTTCACGGTGCAGG + Intergenic
921562562 1:216675964-216675986 TTCCACTGATTCCAATGAGCTGG + Intronic
922618527 1:226977302-226977324 TTCCCCACTTTTCAAAATGCTGG + Intronic
922813416 1:228431668-228431690 TTGCCCTGATCTCAAACTCCTGG - Intergenic
922851559 1:228737297-228737319 TTCCACTGATTTAAAACTGCAGG + Intronic
923447954 1:234089932-234089954 TTCTCCTGGTTTCAAAGGCCTGG - Intronic
923863219 1:237913459-237913481 GTCCCCTGATCTGAAATTGCTGG - Intergenic
923970014 1:239189846-239189868 TCCACCTGATCCCAAAGTGCTGG - Intergenic
924427923 1:243970776-243970798 CTCCCCTGACTTTTAAGTGCTGG + Intergenic
1064310713 10:14209494-14209516 ATCTCCTGACCTCAAAGTGCTGG - Intronic
1065908667 10:30282213-30282235 TTCCTCTGATTTCAAAGAGAAGG - Intergenic
1068117174 10:52748100-52748122 TTGCCCTGGTTTCCCAGTGCAGG + Intergenic
1070548577 10:77473124-77473146 CCTCCCTGATTCCAAAGTGCAGG + Intronic
1071896983 10:90078241-90078263 TTCCTTTGATTTCAAAGGGATGG + Intergenic
1072485127 10:95847565-95847587 TACCCTGGATTTCAAACTGCTGG - Exonic
1073447146 10:103588520-103588542 AGCCCCTGACTTCAAAGAGCTGG - Intronic
1073914941 10:108391789-108391811 TCCTCCTGATTGCAAAGTCCAGG - Intergenic
1074348823 10:112715032-112715054 TAACCCTGATTTCAAAGTTAGGG - Intronic
1074752134 10:116596694-116596716 TGCCCTTGATTTCAAAGAGAAGG - Intronic
1075886840 10:125907401-125907423 TTCCCATGATCTCAATGTCCTGG + Intronic
1077913568 11:6595653-6595675 TTCCCCTGATTTTAAACTCATGG + Exonic
1078180691 11:9007669-9007691 TCCCCTTAATTTAAAAGTGCAGG + Intergenic
1081679357 11:44990806-44990828 TTCCTCTGATTGTGAAGTGCTGG - Intergenic
1083130442 11:60620424-60620446 CTCCCTTGAAATCAAAGTGCAGG + Intergenic
1083298336 11:61727213-61727235 TACCCCTGATTTTTAAATGCTGG - Intronic
1084991566 11:72930500-72930522 TCCTCCTGATCCCAAAGTGCTGG - Intronic
1086416735 11:86596419-86596441 TTCCTCTATTTTCAAAGTACAGG + Intronic
1089637224 11:119822868-119822890 TTTCCCTGACCTCAAAATGCTGG - Intergenic
1093538720 12:20254493-20254515 ATCCCCAGATTTCAAAATACAGG - Intergenic
1093990136 12:25580789-25580811 TTTGTCTGATTTCAAAGTCCAGG - Intronic
1094239467 12:28205416-28205438 TTTCCTTGAATTAAAAGTGCTGG - Intronic
1094247289 12:28313418-28313440 TTCACCTGATTTCAGAATACTGG + Intronic
1094438950 12:30453559-30453581 TTCCTCTGACTTCAGGGTGCTGG + Intergenic
1095317224 12:40779786-40779808 TGCCATTGATATCAAAGTGCAGG + Intronic
1100702829 12:97166030-97166052 TGCCTCTGATTTCTAAGTGCTGG + Intergenic
1102530568 12:113543491-113543513 ATCCCCCGATTTCAGAGAGCTGG - Intergenic
1103359196 12:120343561-120343583 TTCCCCAGATTTCGAATGGCTGG + Intronic
1107599844 13:42002332-42002354 TTCCCCCTATTTCCAAGTGCAGG + Intergenic
1109493425 13:63133703-63133725 TACCCCTAATTTCAAAGTCCTGG + Intergenic
1111173955 13:84567611-84567633 TTCCCATGATTTTAAAGTATAGG + Intergenic
1112227867 13:97558201-97558223 TTTCCATGATTCCAGAGTGCTGG + Intergenic
1112487857 13:99835934-99835956 TTCCCCTGTCTTCCAAGTCCTGG - Intronic
1113319069 13:109214279-109214301 TTCCACTGATTTCTAAATGATGG - Intergenic
1113589065 13:111485433-111485455 TTTATCTGATTTCAAAGTTCAGG + Intergenic
1115101659 14:29708608-29708630 TCCACCTGCTTCCAAAGTGCAGG - Intronic
1117552149 14:56847240-56847262 TTTCCCTTATTTCCAAGTTCTGG - Intergenic
1119919920 14:78437276-78437298 GTAGCCTGATTTCAAAGTTCAGG + Intronic
1120460167 14:84784785-84784807 TCACCCTGAATTCAAAATGCTGG - Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124486594 15:30122747-30122769 TTCCCTTTTTTTCAAAGTCCAGG - Intergenic
1124541669 15:30591726-30591748 TTCCCTTTTTTTCAAAGTCCAGG - Intergenic
1124548334 15:30653522-30653544 TTCCCTTTTTTTCAAAGTCCAGG - Intronic
1124756990 15:32415859-32415881 TTCCCTTTTTTTCAAAGTCCAGG + Intergenic
1124828044 15:33119277-33119299 TTCCCAGGATTTGGAAGTGCCGG - Intronic
1124852449 15:33353635-33353657 AACCCCTGATTTTAAAGTGTAGG - Intronic
1126010833 15:44300765-44300787 TTTCCTTGAATTCAAAGTCCAGG + Intronic
1126052377 15:44697775-44697797 TTCCCATGATTTCACTGAGCTGG - Intronic
1129781612 15:78275940-78275962 TTCCCCTGATTTCACATTTAAGG + Intronic
1130693632 15:86108132-86108154 TTCCCCTTATTTTAATTTGCTGG - Intergenic
1131998540 15:98157017-98157039 TTCACATGATTTCGAAGTGCTGG - Intergenic
1133065988 16:3207377-3207399 TTTCCCTGATGTCAAAGACCTGG - Intergenic
1134272176 16:12742618-12742640 TACCCCTGATTTTTCAGTGCAGG - Intronic
1134617764 16:15664763-15664785 TTCCCCTGTTTTCACAATGGAGG + Exonic
1135406897 16:22205153-22205175 CTTCTCTGATTTCAAAGTTCAGG - Intergenic
1138402887 16:56762732-56762754 ATACCTTGATTTCAAAGTTCAGG - Intronic
1139659831 16:68413108-68413130 TTCACCTGGTGTCAAAGAGCAGG - Intronic
1140159964 16:72479384-72479406 TTGCCCTTATTTAACAGTGCTGG + Intergenic
1140444270 16:75012168-75012190 AAGCCCTGAATTCAAAGTGCAGG + Intronic
1146719520 17:35113966-35113988 CTCCCCTGATTTTAATGTGCAGG - Intronic
1147015939 17:37491111-37491133 TTCCCCTGGTTTTAGAGAGCAGG - Intronic
1150803170 17:68297986-68298008 TTCCCCTGATATCTAATTCCAGG + Intronic
1152146159 17:78570136-78570158 TTGGCCTGCTTTCAAACTGCTGG + Intronic
1154410746 18:14140899-14140921 CTGCCCTGAGTTCTAAGTGCTGG + Intergenic
1158036471 18:53037706-53037728 TCCACCTGATTTCAAAGACCGGG - Intronic
1158568632 18:58577231-58577253 TGCCCCAAATTTCAAAGAGCTGG - Intronic
1159845459 18:73454191-73454213 TTCCACTAATTTCAAATTCCTGG - Intergenic
1161461020 19:4397685-4397707 GCCATCTGATTTCAAAGTGCTGG + Intronic
925439974 2:3877233-3877255 TTCTCCTGATCCCAAAGTTCTGG + Intergenic
925887744 2:8407736-8407758 TTCCCCAGCTTGCAAAGGGCAGG + Intergenic
927392326 2:22609397-22609419 TTCCCCTGTTTCCACAGAGCGGG - Intergenic
927439488 2:23102570-23102592 TTCTCTAGATTTCAAAGTGCTGG + Intergenic
927489738 2:23513144-23513166 TCCCCATGACTTAAAAGTGCAGG - Intronic
928405193 2:31009410-31009432 TTCCCCTGATTTCTCATTGTTGG + Intronic
928952868 2:36830028-36830050 TTGGCCTCCTTTCAAAGTGCTGG - Intergenic
930841094 2:55846100-55846122 TTCCCATCATCTCAAAGTACTGG + Intergenic
935061138 2:99608784-99608806 ATCTCCTGATTTTAAAATGCTGG + Intronic
935210168 2:100932746-100932768 TTACCCTGATTTCCAAGGACTGG - Intronic
937544633 2:123002245-123002267 TTTCCTAGATTTCATAGTGCAGG + Intergenic
939642826 2:144661157-144661179 TGTCCCTGATGTCAAAATGCAGG + Intergenic
942042469 2:172080147-172080169 ATCCCCTGAATTTAAAGTCCTGG + Exonic
942521068 2:176804849-176804871 TTCCTTTGATTAAAAAGTGCTGG + Intergenic
942803176 2:179899322-179899344 TTGCCCTGAGTTCCAAGTGTTGG - Intergenic
944178186 2:196857301-196857323 TTGCCATCATTTCAAAGTGCTGG - Intronic
946965684 2:225035049-225035071 ATCCCCTAATTTCACAGTTCAGG + Intronic
947434569 2:230061988-230062010 TGCCTCGGCTTTCAAAGTGCTGG + Intronic
947547511 2:231020894-231020916 TTCCCCAGATGCCAGAGTGCTGG + Intronic
1170626217 20:18032096-18032118 TTTCCCTGATGTGAAATTGCTGG - Intronic
1170976300 20:21167801-21167823 TTTGCCTGCCTTCAAAGTGCTGG + Intronic
1172377936 20:34461144-34461166 ATCCCATGATTTCACAGTGTAGG - Intronic
1173899134 20:46574237-46574259 TCTCCCTGATTTCAGAGTCCGGG - Intronic
1176138897 20:63536660-63536682 TTGCCCAGTTTCCAAAGTGCCGG - Intronic
1176676775 21:9785984-9786006 TTTCTCTGAGTTCCAAGTGCAGG + Intergenic
1176862317 21:14017519-14017541 CTGCCCTGAGTTCTAAGTGCTGG - Intergenic
1177434269 21:21030295-21030317 GTAGCCTGATTTCAAAGGGCAGG + Intronic
1181763800 22:25076903-25076925 TTTCCCTAATTGCAAAATGCAGG - Intronic
1183771201 22:39927506-39927528 CTGCCCAGATTTCAAAATGCAGG + Intronic
1184537258 22:45095595-45095617 TTCCCCTGATTTGGAAGTTCAGG + Intergenic
950756804 3:15180128-15180150 TTCCTCTGATTTGAAAGATCAGG - Intergenic
952091306 3:29889840-29889862 TTTCCCTGATGTCAACTTGCTGG - Intronic
952991504 3:38834838-38834860 CTTCCCTGATTTCCAAGTGATGG + Intergenic
953311959 3:41889152-41889174 TTCCCTTTTTTTCAAAGTCCAGG + Intronic
955445011 3:59000563-59000585 TTCCCCTGACTTCAAGTTGGAGG - Intronic
955768267 3:62367387-62367409 TGACCCTGATTTCCACGTGCAGG + Intergenic
957380477 3:79421664-79421686 TTACCCTCATTTCACAGAGCAGG - Intronic
957819460 3:85352090-85352112 ATCTCCTGATTTAAAAGTGCAGG + Intronic
959412975 3:106047972-106047994 TGGCCATCATTTCAAAGTGCTGG + Intergenic
959911127 3:111764800-111764822 TAGCTCTGATCTCAAAGTGCAGG + Intronic
960631259 3:119733669-119733691 TTCCCCTCATTTCACATTTCAGG + Intronic
962300888 3:134242050-134242072 TTGGCCTCCTTTCAAAGTGCTGG - Intronic
967241090 3:187440373-187440395 TTATCCTGATTTCAAAGTCAAGG + Intergenic
968929614 4:3571848-3571870 TGCCTCTGCCTTCAAAGTGCTGG + Intergenic
969201461 4:5609706-5609728 TTCCCATGGTTTCACAATGCAGG - Intronic
969537332 4:7764694-7764716 TGTCCCTGCTTTCACAGTGCTGG - Intronic
970035272 4:11727387-11727409 TTCCCCTTTTTTTAAATTGCAGG - Intergenic
970186241 4:13456501-13456523 TTACCCTGATTTCCAGATGCAGG + Intronic
970776207 4:19677396-19677418 TTCCCCAAATCCCAAAGTGCAGG + Intergenic
970884752 4:20975514-20975536 TTCCCCTAACTTCACACTGCTGG - Intronic
970903156 4:21183709-21183731 GTTCCCTGATTTCCAATTGCAGG + Intronic
973863669 4:55090576-55090598 TTCCCCTGATTTCAAAGTGCTGG + Intronic
973954626 4:56049840-56049862 TTCCCCTGTTTACCAAGGGCCGG + Intergenic
976958810 4:90940903-90940925 TTTTCCTGATTCCAAAATGCTGG + Intronic
978386419 4:108180049-108180071 TTGCCTTGATTCCAAACTGCTGG - Intergenic
982432965 4:155344167-155344189 TTCCCCTCACTTTAAAGTGTAGG + Exonic
984093459 4:175404551-175404573 TATATCTGATTTCAAAGTGCTGG + Intergenic
985170074 4:187139289-187139311 ATACCCTCATTTCAAAGTCCAGG - Intergenic
985398762 4:189572800-189572822 TTTCTCTGAGTTCCAAGTGCAGG - Intergenic
991204198 5:64031315-64031337 TTTCCCTGATTTCCAAGTCTTGG - Intergenic
992638887 5:78751632-78751654 TTCACCCGACTTCAAAGGGCAGG - Intronic
993216491 5:85029679-85029701 TTCCACTGATTTCAGAGTTCTGG - Intergenic
994135405 5:96280892-96280914 TTCACCTGGCTTCAAAGTACAGG - Intergenic
994380296 5:99062646-99062668 TTCTCCTGATTGCTAAGTGGAGG + Intergenic
995789930 5:115875542-115875564 TTCCCACAATTTCCAAGTGCTGG - Intronic
996161506 5:120172857-120172879 TGCCCCTGATTTCCAAATGTTGG - Intergenic
996435581 5:123430032-123430054 TTCCTCTGAATTCAAAGGGGAGG - Intergenic
999786491 5:154895191-154895213 TTTCCCTCATTTCAAAATGAGGG - Intronic
1001171708 5:169425475-169425497 TTCCCCTAATTCATAAGTGCTGG - Intergenic
1001579620 5:172789881-172789903 GTCCCCTGACCCCAAAGTGCAGG + Intergenic
1002218447 5:177658544-177658566 TTCCTATCACTTCAAAGTGCTGG - Intergenic
1002894830 6:1371672-1371694 TTACTCAGAATTCAAAGTGCTGG - Intergenic
1003905063 6:10691810-10691832 TTCCACTGATTTCTAAGTTTTGG + Intronic
1004048465 6:12049248-12049270 TTCACCTGTTTTTAAGGTGCAGG + Intronic
1005492668 6:26361017-26361039 TTCCTCTGATTTCAACAAGCAGG + Intergenic
1006389434 6:33749811-33749833 TTCCCCTCATTTCACAGTGGAGG + Intergenic
1011260654 6:85466388-85466410 TTCCCCAGATGTGAAACTGCTGG + Intronic
1013326430 6:109048773-109048795 TTCCCCTGATTCTAAATTCCAGG + Intronic
1013702282 6:112787413-112787435 TTCCCCTGATTCAAAACTACTGG + Intergenic
1015151988 6:130050167-130050189 TTCCTCTGGCTTCAAGGTGCAGG - Intronic
1015755765 6:136604583-136604605 GTCCCCAGATCTCAAAATGCTGG + Intronic
1017076271 6:150621702-150621724 TTTCCCAGTTTTCAAATTGCGGG - Intronic
1018881148 6:167882414-167882436 AACCCCTGACCTCAAAGTGCTGG - Intronic
1018889730 6:167975250-167975272 TTCCCCCTATTACAAAGTTCTGG - Intergenic
1021984733 7:26087447-26087469 TTCCAGTGATTTCCAAGTGTGGG - Intergenic
1022568473 7:31427567-31427589 CTCAGGTGATTTCAAAGTGCAGG + Intergenic
1022750948 7:33225056-33225078 TTTCCCTGTTTTCAAAATTCAGG + Intronic
1024115940 7:46193144-46193166 AGCCACTGTTTTCAAAGTGCTGG + Intergenic
1026427068 7:70305772-70305794 TTTCCATCATTTCAAGGTGCTGG + Intronic
1026969637 7:74460196-74460218 TTCAAGTGATCTCAAAGTGCTGG + Intronic
1030196070 7:106855042-106855064 TACCCCTAATTTCAAAGGGTGGG + Intergenic
1030519575 7:110581396-110581418 TTGCCCTGGTTTCAAACTCCTGG - Intergenic
1031114410 7:117652259-117652281 TTCCACTGATTTCTAAGTTGAGG + Intronic
1032303300 7:130709591-130709613 TTCTCCTGATCTCAAAGCACAGG + Intergenic
1033560450 7:142525824-142525846 TTCCCCTAATTTTAGAATGCAGG - Intergenic
1036195640 8:6711678-6711700 ACACCTTGATTTCAAAGTGCTGG - Intronic
1036940896 8:13050722-13050744 TTCCCCAGAGTCCAAAGTGAAGG - Intergenic
1038941497 8:32310749-32310771 TTCACCTCATTTGAAAGTCCAGG + Intronic
1042663732 8:71183310-71183332 TTCCCCTGAATTCACAGTAATGG - Intergenic
1044248680 8:89981410-89981432 ATCCCCCGACTTCAAAGTTCGGG + Exonic
1046616090 8:116478859-116478881 TTCCCTTGATTGGAAATTGCAGG - Intergenic
1054460666 9:65460623-65460645 TGCCTCTGCCTTCAAAGTGCTGG - Intergenic
1054830201 9:69616566-69616588 TAGCTCTCATTTCAAAGTGCTGG - Intronic
1056846959 9:90046622-90046644 TTCCCCAGATTTAAAACTGGAGG - Intergenic
1060049649 9:120369065-120369087 TTCTCCTGACTTGACAGTGCTGG - Intergenic
1060731197 9:126038138-126038160 TTCCCCTGCTTTCCATGGGCTGG - Intergenic
1186625897 X:11292994-11293016 TTCTCCTGATCTGAAAGGGCTGG + Intronic
1186948331 X:14594395-14594417 TTCTCATTATTTCAATGTGCAGG + Intronic
1187040630 X:15591617-15591639 TATCCCTGATATCAAAGGGCAGG + Intronic
1193521049 X:82528962-82528984 TTCCCATGCTTTTAAAGTGGTGG - Intergenic
1200143194 X:153912370-153912392 TTCCCCTTATTTCACTGTCCAGG + Intronic