ID: 973864829

View in Genome Browser
Species Human (GRCh38)
Location 4:55101975-55101997
Sequence CACTATCCGCAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973864829_973864837 18 Left 973864829 4:55101975-55101997 CCTTCCTCACTCTGCGGATAGTG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 973864837 4:55102016-55102038 TTCAATACAATGCCTAACAGAGG 0: 1
1: 0
2: 0
3: 12
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973864829 Original CRISPR CACTATCCGCAGAGTGAGGA AGG (reversed) Exonic
900610246 1:3541672-3541694 CACTGTCCCCAGGGAGAGGAAGG - Intronic
902028939 1:13407014-13407036 CACCATCCCCAGATTGGGGAAGG + Intergenic
905199728 1:36307505-36307527 CCCTCTCCCCAGATTGAGGACGG + Exonic
912250294 1:108004714-108004736 CACTCTCTGGAGAGTGAGAATGG + Intergenic
920220382 1:204394460-204394482 CAGTATCTGCTGAGTTAGGAGGG + Intergenic
923703298 1:236320379-236320401 TACTAGCCACAGAGTGAAGATGG - Intergenic
1066449046 10:35511438-35511460 CACTGTCAGCAGAGTGCTGAAGG + Intronic
1067138445 10:43632992-43633014 CACTATAAAAAGAGTGAGGAAGG - Intergenic
1069778339 10:70939661-70939683 CACTAGCAGCAGTGTGAGCAAGG + Intergenic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1083479565 11:62934888-62934910 CATTATCCTCAAGGTGAGGAAGG - Intergenic
1084677716 11:70645986-70646008 CACGCTCAGCAGTGTGAGGAAGG - Intronic
1086791014 11:91038318-91038340 CTCTATCCGCAGCATGAAGATGG - Intergenic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1091896700 12:4110769-4110791 GACTATCCTTAGAGTGAGGGTGG + Intergenic
1101543661 12:105689065-105689087 CACTATCTGGAGAGTGAAGGTGG + Intergenic
1102915227 12:116747520-116747542 CATTATCCACAGAGTGAGACGGG - Intronic
1106502248 13:30340053-30340075 TACTTTCCCCAGAGTGAGGGAGG - Intergenic
1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG + Intergenic
1118456375 14:65948668-65948690 CTCTATCCGCAGAGGGCAGAGGG + Intergenic
1121507795 14:94489885-94489907 CTCCATCCACAGAATGAGGAGGG + Intronic
1122623464 14:103072642-103072664 CCTTATCTGCACAGTGAGGAGGG - Intergenic
1124106420 15:26741864-26741886 AACTCTCCAAAGAGTGAGGAGGG - Intronic
1130901433 15:88209725-88209747 CACTACCCAGAGAGTGAGGCAGG + Intronic
1135435708 16:22425473-22425495 CGCTGTTCCCAGAGTGAGGATGG - Intronic
1137973292 16:53007198-53007220 CACTTTCTGTGGAGTGAGGAAGG - Intergenic
1139264896 16:65629350-65629372 CAATAGCCGAGGAGTGAGGAAGG - Intergenic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1149283623 17:55135994-55136016 CACTATCAGCAGTGTGACAATGG + Intronic
1152245968 17:79184737-79184759 CACTGTCTGCAGTGAGAGGAGGG - Intronic
1152385041 17:79968555-79968577 CACTATCAAGAGAGTGAGGCCGG + Intronic
1152408584 17:80110892-80110914 GACTCTGCCCAGAGTGAGGAGGG - Intergenic
1153666227 18:7369722-7369744 CGCTACCCTCAAAGTGAGGAGGG + Intergenic
1160522842 18:79518675-79518697 TACTCACCGCAGTGTGAGGATGG + Intronic
1163834264 19:19563554-19563576 CAGAGTCCGCAGGGTGAGGAAGG + Exonic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
926886660 2:17604519-17604541 CACTTTCCGCAGAGAGAAGCTGG + Intronic
927062067 2:19432621-19432643 CAGTAGCCCCAGAGCGAGGAGGG + Intergenic
934845867 2:97660991-97661013 CACCATCCACAGACTGAGGGAGG + Intronic
935386853 2:102509027-102509049 CACTCTTGGCAGAGTGGGGAAGG - Intronic
935541544 2:104354415-104354437 CACCTTCCGGAGAGTGAGGCCGG + Intergenic
936284722 2:111173254-111173276 CCCTAATGGCAGAGTGAGGATGG - Intergenic
938220619 2:129563608-129563630 CACAAGCCACAGAGTGGGGAAGG - Intergenic
938686944 2:133747634-133747656 CACTATCATCAGAGTGAAAAGGG + Intergenic
944298997 2:198101098-198101120 CACTAGCCTCAGTGTTAGGATGG + Intronic
1168912582 20:1461367-1461389 CACGCTCAGCAGAGTGGGGATGG + Intronic
1172861395 20:38056014-38056036 TAGTATGCGCAAAGTGAGGACGG + Intronic
1174087794 20:48021445-48021467 CCCCATCCGTAGAGTAAGGAGGG + Intergenic
1174202219 20:48814693-48814715 CACCTCCAGCAGAGTGAGGATGG + Intronic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1179399408 21:41070110-41070132 CACTCTGGGGAGAGTGAGGAGGG - Intergenic
1182557258 22:31135983-31136005 CACTGTCTGCAGAGTAAGGTGGG - Intronic
1183933593 22:41249517-41249539 CACTATCAGCAGAGTCTGGATGG - Intronic
949819741 3:8103337-8103359 CACTATCAGCAGGGAAAGGAAGG + Intergenic
956700928 3:71957841-71957863 CTTTATCAGCAGTGTGAGGATGG - Intergenic
958052242 3:88363121-88363143 CACTGCCTGCAGAGTGGGGATGG + Intergenic
960122104 3:113957424-113957446 TACTCTCCACACAGTGAGGAAGG - Intronic
962321273 3:134392640-134392662 CACTGTGCTCAGAGTGAGGCTGG - Intergenic
969528121 4:7714439-7714461 CACTTCCCTCAGAGTGAGGGAGG + Intronic
973864829 4:55101975-55101997 CACTATCCGCAGAGTGAGGAAGG - Exonic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
981959884 4:150523742-150523764 GACTATCCTCAGAGGGAGGTGGG + Intronic
984364200 4:178777245-178777267 CACCATGGGCAGAGTGAGGCAGG + Intergenic
990695227 5:58408935-58408957 TACTATCCTCAGAAAGAGGATGG - Intergenic
997259858 5:132457415-132457437 CACTAACCACACAGAGAGGAAGG + Intronic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
999328846 5:150659539-150659561 CACTATCACCAGAGTGGGCAGGG + Intergenic
1008098201 6:47361674-47361696 CACTACCGGCAGAGTGGGCAAGG - Intergenic
1014880944 6:126723757-126723779 GACTAGCAACAGAGTGAGGAAGG + Intergenic
1022247196 7:28571717-28571739 CCTTATCCCCAGAATGAGGATGG + Intronic
1024340646 7:48255158-48255180 CACTAACCTCTGAGTGAGAAAGG + Intronic
1026189617 7:68112926-68112948 GATTAACCGCAGAGTGGGGAGGG + Intergenic
1033987500 7:147244224-147244246 TACTCTCCACAGAGTGTGGAAGG + Intronic
1037775950 8:21835823-21835845 TACTACCCACAGTGTGAGGAGGG + Intergenic
1044893084 8:96858037-96858059 CACTCTCCTAAGAGTGAGGTAGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1061646269 9:132004611-132004633 CCCTTCCTGCAGAGTGAGGATGG - Intronic
1189163788 X:38838711-38838733 CACTACCCTCAGAGAGGGGAAGG + Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1192168070 X:68838426-68838448 CACTACCAGGAGAGTGTGGAAGG - Intronic
1197947988 X:131861497-131861519 CAGTATCCACAGAGTGATGAAGG + Intergenic
1198959489 X:142169263-142169285 CACTATTCCCAGCCTGAGGAAGG - Intergenic
1200810661 Y:7481167-7481189 AACTATCACCAGAGTGAGCAGGG - Intergenic