ID: 973865403

View in Genome Browser
Species Human (GRCh38)
Location 4:55107881-55107903
Sequence ATCTGGGGTGGGACTGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973865396_973865403 6 Left 973865396 4:55107852-55107874 CCACAGGAGAGATTAGAGATTTC 0: 1
1: 0
2: 3
3: 15
4: 166
Right 973865403 4:55107881-55107903 ATCTGGGGTGGGACTGAAGATGG 0: 1
1: 0
2: 3
3: 23
4: 271
973865394_973865403 22 Left 973865394 4:55107836-55107858 CCGTACTGGTAGGAATCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 83
Right 973865403 4:55107881-55107903 ATCTGGGGTGGGACTGAAGATGG 0: 1
1: 0
2: 3
3: 23
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973865403 Original CRISPR ATCTGGGGTGGGACTGAAGA TGG Exonic
900244158 1:1629979-1630001 ATCTGGGGTGGGGCTATGGAGGG - Intronic
901781916 1:11599781-11599803 ATCTGGCGCTGGACTGGAGATGG + Intergenic
903545196 1:24119609-24119631 GTCTGGGGTGGGAAAGAGGAGGG - Intergenic
903892414 1:26578511-26578533 ATCTGGGGTGGAAGGGAAGCTGG + Intergenic
904065507 1:27747105-27747127 TTCTGGGGTGGGACTGCTGCAGG - Intronic
904124070 1:28223792-28223814 CTGTGGGGTTGGACTGAAAATGG + Intronic
904613094 1:31735892-31735914 AGCTGGGGTGGGGGAGAAGAAGG + Exonic
904730041 1:32583418-32583440 ATCTGGGGTGGGAGTTCAGATGG + Intronic
905751422 1:40467968-40467990 TGCTGGGGTTGGACGGAAGATGG - Intergenic
906299865 1:44674144-44674166 CTCTGGGGCGGGACTTACGAGGG + Intronic
907372166 1:54010628-54010650 AGCTGGGGAGGAACTGAGGAAGG - Intronic
907430811 1:54410192-54410214 AAGTGAGGTGGGAGTGAAGACGG + Intronic
910297123 1:85659276-85659298 TTCTGGGGTGGGAGTGAAAGGGG + Intronic
910559126 1:88571206-88571228 AACTGGGGTGGGAGTAAGGAAGG - Intergenic
911050649 1:93668126-93668148 TCCTGGGGTGGGAGTGAGGAGGG + Intronic
911645125 1:100329643-100329665 GACTGAGGTGGGAATGAAGAAGG - Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913208025 1:116559216-116559238 ATCTGGGGTGAGAGTGAGAAAGG + Intronic
914247233 1:145895494-145895516 ATCTGGAGTGGGAATGAAAATGG - Intronic
914917844 1:151829339-151829361 ATCTGTGGGGGGACTGAGGTTGG - Intronic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
915561917 1:156692674-156692696 AGCTGGGGTGGGCCTGCAGTGGG + Intergenic
917703973 1:177612935-177612957 ATCTGCTGTGGGACAGAGGATGG - Intergenic
918029384 1:180789838-180789860 CTCTGGGGTAGGCATGAAGAAGG - Intronic
919824869 1:201496255-201496277 ATGTGGGGTGTGTCAGAAGACGG - Exonic
920116156 1:203623320-203623342 AGCTGGGGTGGGAATGGAGTGGG + Intergenic
920567688 1:206988466-206988488 GTTTGGGGTGGGATTGAAAATGG - Intergenic
921269758 1:213457004-213457026 ATCTGGGCTAGGACTCAAGAAGG + Intergenic
921271189 1:213471634-213471656 AGTTGGGGTGGGAATGAAGTTGG + Intergenic
923028357 1:230225403-230225425 GTTTGGGGTTGGACTGAGGAGGG + Intronic
923636365 1:235701174-235701196 TTCTGAGGTGGGAATGAAGCAGG + Intronic
924097904 1:240573546-240573568 CTCTGGCGTAGGACTTAAGAGGG - Intronic
1063487625 10:6434782-6434804 ATCTGAGGAGGGACTGAAGAGGG - Intronic
1063568782 10:7195650-7195672 ATCTGGGGTGCGGGTGATGAAGG - Intronic
1067172742 10:43921631-43921653 AGCTGGGGTTGGTCTGGAGACGG + Intergenic
1068656581 10:59582161-59582183 TGCGGGGGTGGGACTGTAGAAGG + Intergenic
1069616730 10:69811100-69811122 GGCTGGGGTGGGAGTGAGGATGG - Intronic
1070117784 10:73545488-73545510 ATATGGGGTGGGACTGCTGATGG - Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1072749306 10:97965833-97965855 AACTGAGCTGTGACTGAAGAAGG + Intronic
1074036731 10:109746633-109746655 ATCTGGAGTAGGACTTAAGTGGG - Intergenic
1074827298 10:117223762-117223784 AGGTGGGGTGGACCTGAAGAGGG - Intergenic
1076856460 10:133117639-133117661 ATCTGGAATGGGCCTGGAGAAGG + Intronic
1077420434 11:2447453-2447475 ATGTGGGGTGGGACTGGAGGTGG + Intronic
1080158194 11:29138083-29138105 ATCTGTGGTTGGTCTGTAGAGGG + Intergenic
1080890921 11:36408610-36408632 ATCAGGGGTGAGGCTGGAGAGGG - Intronic
1081984623 11:47292673-47292695 ATTTGGGGTGGGGCTGACAAAGG - Intronic
1084717324 11:70882288-70882310 CTCCGGGGTGGGACGGGAGAGGG + Intronic
1085555762 11:77420140-77420162 ATTTGGGTTGGTATTGAAGAAGG + Intronic
1086046021 11:82533051-82533073 ATGTGGGGTGGGAGAAAAGAAGG + Intergenic
1087468795 11:98545671-98545693 CTCTGGGGAGGGACTGAATCTGG + Intergenic
1088858656 11:113779777-113779799 ATCTGTGGTGGGAGTGACTATGG + Exonic
1088922008 11:114266536-114266558 ATATGGGGTGGGACTGGGGGTGG - Intronic
1089360084 11:117879816-117879838 TCCTGGGGTGGGGCTGCAGAAGG + Intergenic
1089489198 11:118871350-118871372 ATCTGGGGTGGGTCTGAGTTTGG - Intergenic
1090203313 11:124871004-124871026 AACTGGGGTGGGACTGGGAAGGG - Exonic
1091287934 11:134418865-134418887 ATTTGGGGAAGGACTGGAGAAGG + Intergenic
1093013346 12:14131165-14131187 ATCTGAGGTGGGAGTGGTGAGGG - Intergenic
1096836562 12:54354973-54354995 TTCTGAGGTGGGACTGAGGTAGG + Intergenic
1096924910 12:55133288-55133310 ATATGGGGTGGGAGTGGAGGTGG + Intergenic
1097718826 12:62998627-62998649 ATATGGGGTGGGGAAGAAGAAGG + Intergenic
1098426590 12:70371289-70371311 AACTTAGGTGGGACTGAATAAGG + Intronic
1100712801 12:97275845-97275867 GTCTGGGGTGGGAGTGGGGAGGG - Intergenic
1102016881 12:109654117-109654139 ATCTTGGGCGGGACTGAGAAAGG + Intergenic
1102509351 12:113403735-113403757 TCCTGAGGTGGGACTGAGGATGG + Intronic
1104794291 12:131506380-131506402 GCCTGGGCTGGGACTGCAGAAGG + Intergenic
1106247932 13:27964760-27964782 ATCTGTGGAGAGACTGAAGCAGG - Intronic
1106407729 13:29488278-29488300 CCCTGGGGTGGGACTGAGGCTGG - Intronic
1106935216 13:34711072-34711094 AGCTGGTGTGGTAATGAAGATGG - Intergenic
1108091127 13:46850988-46851010 TTCTGGGGTGGGGGTGAGGATGG + Intronic
1108545882 13:51492841-51492863 ATCTTGGGTGGGACAGAGCAGGG + Intergenic
1110436145 13:75480917-75480939 GTCTGGGGTGTGACCGGAGATGG - Intronic
1112502754 13:99955428-99955450 TTCTCTGGTGGGACTGAAGAGGG - Intergenic
1113072618 13:106436141-106436163 TTGTGGGGTGGGGCAGAAGAAGG + Intergenic
1113603623 13:111588964-111588986 GTCTGGGGTGGGTCTGGCGAGGG + Intronic
1113867381 13:113535909-113535931 GTCTGGGGAGGGACTGGGGATGG + Intronic
1114257632 14:21016917-21016939 ATCTAGAGTGGGACTGGGGAGGG - Exonic
1115344141 14:32324149-32324171 ATGTGGGGTGGAAGTGAAGAAGG + Intergenic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1120142141 14:80941445-80941467 ATCTGGGGTGGGGCCGTGGATGG - Intronic
1120481746 14:85057709-85057731 ATATGGGGTTTGACAGAAGAAGG + Intergenic
1120501925 14:85308157-85308179 AGCTAGGGTGGGAATGAAGAGGG - Intergenic
1120512075 14:85427122-85427144 ATCTGGGTTGGGAGAAAAGAGGG - Intergenic
1121328420 14:93034923-93034945 ACCTGGGGTGGGGCTGGAGAAGG - Intronic
1123756854 15:23403637-23403659 ATCTGGGCTGTGTCTGAAGCGGG - Intergenic
1124019761 15:25909590-25909612 GTCTGGGGTGGGCCAGGAGAAGG - Intergenic
1124192155 15:27589256-27589278 ATCAGGGTTGGCACAGAAGATGG - Intergenic
1125668460 15:41451748-41451770 TTCTGGGGTGGGTCTCAGGAAGG - Intronic
1126530945 15:49710716-49710738 CACTGGGGTGGGACTGATGCTGG + Intergenic
1126769105 15:52037322-52037344 CTCTGGTGAGGGTCTGAAGAAGG - Intronic
1127291278 15:57573658-57573680 AACAGGGGTGGGAATGCAGAAGG + Intergenic
1128312758 15:66641791-66641813 GGCTGGGGTGGGACTCAAGTGGG + Intronic
1129160153 15:73742873-73742895 GTCTGGGGTGGTGCTGGAGAAGG + Intronic
1129174972 15:73833285-73833307 ATCTGTGATAGGAGTGAAGATGG - Intergenic
1129250358 15:74305404-74305426 ATTAGGGGTGGGCCTGGAGAGGG + Intronic
1131035060 15:89216706-89216728 ATGTGCAGTGGAACTGAAGATGG - Intronic
1134459482 16:14419125-14419147 ATCTGGGCTGTGTCTGAAGCCGG + Intergenic
1135560650 16:23474224-23474246 ATTTGGGTTGGGATTCAAGAAGG - Intronic
1137236615 16:46623427-46623449 AACTGGGCTGGGAGAGAAGATGG - Intergenic
1137856003 16:51795311-51795333 ATCTGGGGTGAGGGTGCAGAGGG - Intergenic
1139489060 16:67276909-67276931 ATTTGGGGTAGTACTGAAGAGGG + Intergenic
1139581655 16:67877423-67877445 GTGGGTGGTGGGACTGAAGAAGG + Intronic
1142768995 17:2083192-2083214 ATCTAGGGTGGGCCTGCAGCAGG - Intronic
1142864466 17:2782236-2782258 TTCTGGGCAGGGCCTGAAGAGGG + Intronic
1143982259 17:10880134-10880156 ATCTGGGGTACGACTATAGAGGG + Intergenic
1144156438 17:12508631-12508653 ATCTGGGGCTGGAAAGAAGAGGG - Intergenic
1145115911 17:20210801-20210823 ATGTGGGGTGGGACTGCAAGTGG - Intronic
1145201960 17:20953670-20953692 ATCTGGGATGTAACTAAAGAAGG + Intergenic
1146651416 17:34609161-34609183 GTCTGGGGGGTGTCTGAAGAAGG + Intronic
1149152017 17:53577963-53577985 ATGGGGGGTGCTACTGAAGAGGG - Intergenic
1149386691 17:56149653-56149675 ATCTGGGGAGGGACTGAGAATGG - Intronic
1149446729 17:56718974-56718996 ACCTGGGGAGAGACTGAAGGAGG + Intergenic
1150177061 17:63068967-63068989 ATTTGGGGAGGGATGGAAGAAGG + Intronic
1150606003 17:66691575-66691597 ATCAGGGATGGGGCTCAAGAAGG - Intronic
1150631166 17:66881448-66881470 GTGTGGGGTGTGACTGGAGAGGG - Intronic
1152525809 17:80887653-80887675 CTCTGGGGTGGGAGAGAGGAGGG + Intronic
1152707968 17:81855086-81855108 TTCTGGGGTTGGTCTGCAGAGGG - Intronic
1153235295 18:2980448-2980470 ATTTGGGGTGGGGCTGAGGTTGG - Intronic
1153864319 18:9249590-9249612 ATCTGTTGTGGGAAGGAAGACGG - Intronic
1155021616 18:21901986-21902008 ATTTGGGGTGGGGTTGAAAAGGG - Intergenic
1155059839 18:22218853-22218875 TTATGGGGTGGGAGTGAGGAAGG + Intergenic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1160622111 18:80178897-80178919 TTCTGGGGAGGGAGTGAGGAAGG + Intronic
1160756178 19:758136-758158 ATCTGGGGCCGGGCTGAGGATGG - Exonic
1161681615 19:5682440-5682462 AGCTGGGGAGAGACTGGAGAGGG + Intronic
1162085107 19:8243963-8243985 AAGTGGGGTGAGGCTGAAGATGG + Intronic
1163783344 19:19261771-19261793 ATCTGGGGCAGGACTGAGGGCGG - Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164828650 19:31303233-31303255 CTCTGGGAAGAGACTGAAGATGG + Intronic
1165329172 19:35131823-35131845 ATCTGGGGAGGGTCTCCAGATGG + Exonic
1166193188 19:41189514-41189536 ATCTACGGTGGGAGGGAAGAGGG - Intergenic
1166373923 19:42316555-42316577 ATCTTGGGTGAGAATGAAGCTGG + Exonic
1166685570 19:44794183-44794205 ACCTGGGGTGGGACAGAGGAAGG - Exonic
1167369275 19:49071245-49071267 CTCTGGGCTGGGACTGTGGAGGG - Intronic
1168304960 19:55430191-55430213 ATCTGTGGTGGGATTGATGCAGG + Exonic
926119941 2:10236358-10236380 AACAGGGGTGGGGATGAAGATGG - Intergenic
927004208 2:18831108-18831130 ATGTGGGGTGGCAGTGAACAGGG - Intergenic
927944891 2:27129688-27129710 ATGTGGGTTGGGACAGAGGAAGG - Intronic
929010946 2:37443528-37443550 ATTTGGGGTGGGAGTGAGGAAGG + Intergenic
932903008 2:75721642-75721664 ATCTTGGGTAGGACTGAAACTGG + Intergenic
933711328 2:85328019-85328041 AGCAGGGGCGGGACTGGAGAGGG - Exonic
933916289 2:86997222-86997244 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
934006704 2:87772683-87772705 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
934857748 2:97739539-97739561 ACCTGGGGTGGGGCTGAGGGTGG - Exonic
934918003 2:98316533-98316555 ACTTGGGGTGGGGCTGAAGTGGG + Intergenic
935770351 2:106413604-106413626 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
935967860 2:108499212-108499234 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936131519 2:109847469-109847491 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936213178 2:110524016-110524038 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936422317 2:112378573-112378595 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936542551 2:113363961-113363983 GTGTGGGGAGGAACTGAAGAAGG - Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
938054389 2:128203115-128203137 AGCTGAGGTGGCACTGAGGAGGG - Intergenic
938573474 2:132583640-132583662 ATATGGGTTGAGATTGAAGAGGG + Intronic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
939461080 2:142495559-142495581 GTGGGGGCTGGGACTGAAGAAGG - Intergenic
940130002 2:150370186-150370208 ATCTGGGCTGGGGCAGAAGCCGG + Intergenic
941043809 2:160650481-160650503 AGTTAGGGTGGAACTGAAGAGGG - Intergenic
945285660 2:208078851-208078873 CTCTGGGCTGGTACTGAGGAGGG - Intergenic
945513003 2:210725736-210725758 ATGAGGGGTGGGAGTGAAGAGGG + Intergenic
946445399 2:219735517-219735539 ATCAAGGGAGGGAGTGAAGAGGG - Intergenic
946450027 2:219771838-219771860 ACCTGGGGATAGACTGAAGAAGG - Intergenic
948119937 2:235522520-235522542 AGCTGGGGAGGGAAGGAAGACGG + Intronic
948583199 2:239002170-239002192 ATCTCGGGTGAAACGGAAGACGG - Intergenic
1168964701 20:1892417-1892439 ATCTGGGGTGGGAGTGGAGATGG - Intergenic
1171005707 20:21463644-21463666 ATCTGGGGTTGGACGGAAACAGG - Intergenic
1172336098 20:34116928-34116950 ATCTGGGGTGGTATTGAGCATGG - Intergenic
1173008467 20:39158991-39159013 ATCTTGACTGAGACTGAAGAAGG - Intergenic
1175180808 20:57145779-57145801 CACTGGGGTAGGAGTGAAGAGGG - Intergenic
1175289222 20:57862716-57862738 AGCTGGAGAGGGACTGAAGGTGG - Intergenic
1175401210 20:58701061-58701083 ATCTGGGGTGTGGCTGAGGACGG - Exonic
1175983751 20:62754163-62754185 AGCTGGGGTGGGAGGGAGGAAGG + Intronic
1177925938 21:27215319-27215341 GTTTGGGGTGGGAGTGGAGAAGG + Intergenic
1178319154 21:31591738-31591760 ATCAGAGTTGGGACTGTAGAGGG + Intergenic
1179182985 21:39061356-39061378 ATCTGGAGAGGGGCTGAAGATGG - Intergenic
1179989156 21:44937584-44937606 GTATGGGGTGGGACTGCAGAAGG - Exonic
1180002598 21:45002075-45002097 AGCTGGGGAGGGGCTGGAGAGGG + Intergenic
1183228914 22:36568801-36568823 ATTTGGGGGGGACCTGAAGAAGG + Intronic
1183335513 22:37243905-37243927 GGGTGGGGTGGGGCTGAAGAGGG + Intronic
1183462117 22:37957800-37957822 GTCTGGAGTGAGACTGAAGCAGG - Intronic
1183483870 22:38079016-38079038 ATCTGGGGTGGGAGCGGGGAGGG + Intronic
1183859659 22:40660605-40660627 AGCTGGGGTGGGACTGAGGCAGG + Intergenic
1184112324 22:42402543-42402565 CTATGGGGTGGGACAGAACAAGG + Intronic
1184339679 22:43879340-43879362 CCCTGGGGTGAGACTGAAGGAGG - Intergenic
1184411437 22:44328620-44328642 CTTTGGGGTGGGGCTGGAGAGGG + Intergenic
1184653960 22:45931975-45931997 ATCTGGAGACGGACTGAAGGCGG - Intronic
1184988384 22:48151584-48151606 AGCTGGGGAGGGAAAGAAGACGG + Intergenic
950352981 3:12375367-12375389 ATCTGGGGTGGGAGAGAAATTGG - Intronic
950580720 3:13860299-13860321 AGCTGGGGTGGGGCTGAGGAAGG - Intronic
952499951 3:33951857-33951879 GTCTGGCATGGGAGTGAAGAAGG + Intergenic
952823561 3:37506109-37506131 AGCTGGGGTCAGACAGAAGAGGG + Intronic
953344463 3:42163595-42163617 GTCTGGAGTGGGACCCAAGAAGG - Intronic
953833372 3:46322178-46322200 ATCTGGGGTGGGGCTGAGGAGGG - Intergenic
954371210 3:50170407-50170429 AGCTGGGGTGGGAATGGGGATGG + Intronic
954982328 3:54757619-54757641 ATTTTGAGTGGGAATGAAGATGG + Intronic
955822640 3:62912373-62912395 ATCGTGGGTGGGACTGGACAAGG + Intergenic
956556411 3:70528227-70528249 ATCTGGGTAGGGGGTGAAGAAGG - Intergenic
956681584 3:71785927-71785949 AGCTGGCGCGGGGCTGAAGAGGG - Intergenic
956726163 3:72158171-72158193 AGCTGCAGTGGGAATGAAGAGGG + Intergenic
960057996 3:113289651-113289673 ATGTGGGAGGGGACTGAACAGGG - Exonic
960148709 3:114230616-114230638 CTTTGGGGTGTGACTGAGGAAGG - Intergenic
961749735 3:129088125-129088147 AACTGGGCTGGGAGAGAAGACGG - Exonic
964454024 3:156841098-156841120 ATCTGCTGTGAGAATGAAGAAGG + Intronic
964499753 3:157335644-157335666 GTCTAGTGTGGGACAGAAGAAGG + Intronic
969343632 4:6557940-6557962 GTCTGGGGTGGGGCTGGGGAGGG - Intronic
971089812 4:23328428-23328450 TTCTGGAGTAGGTCTGAAGAAGG - Intergenic
971639524 4:29113292-29113314 ATCTGGTGTAGGACAGATGAGGG - Intergenic
971765899 4:30831291-30831313 TTCTGGAGTGGGTCTCAAGACGG - Intronic
973865403 4:55107881-55107903 ATCTGGGGTGGGACTGAAGATGG + Exonic
974831146 4:67191150-67191172 ATCTGAGGTTTGCCTGAAGAAGG - Intergenic
979472364 4:121114493-121114515 ATCTGGGCTGAGACTAAAGCAGG + Intergenic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
982778326 4:159465192-159465214 ATCTGCTGTGGGATGGAAGATGG + Intergenic
983994088 4:174159936-174159958 AACTCGTGTGGGATTGAAGACGG + Intergenic
985073348 4:186190426-186190448 CTATGGAGTGGGAATGAAGATGG - Intergenic
985151864 4:186955401-186955423 GTTAGGGGTGGGAGTGAAGATGG - Intergenic
988787359 5:34577354-34577376 CTCTGGGCTGGGCCTGCAGAAGG + Intergenic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
990168083 5:53017608-53017630 AGCTGGGGTGGGGCTCCAGAAGG + Intronic
992352055 5:75939944-75939966 ATCTTGGGTAGAACTGAAGGCGG - Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997333555 5:133085959-133085981 AACTGGGCTGGGAGTGAGGAGGG + Intronic
998097248 5:139403050-139403072 ATATAGGGTGGGCCAGAAGAGGG + Intronic
998138414 5:139686701-139686723 ATGTGGGCTGGGACTGACCAGGG + Intergenic
998760387 5:145425762-145425784 TTCTGGGGCGGGAATGACGATGG + Intergenic
998788054 5:145733974-145733996 CTATGGGGAAGGACTGAAGATGG + Intronic
999127295 5:149254984-149255006 TTCTAGGAGGGGACTGAAGAAGG + Intronic
999650661 5:153764359-153764381 CTCTGGGGAGGGACTGAGCACGG - Intronic
999715229 5:154355109-154355131 AGCTGGGGTGGGACAGATGAGGG + Intronic
1001646973 5:173289373-173289395 ATCAGGGGTGGGAAACAAGAGGG - Intergenic
1002104963 5:176875475-176875497 GACTGGCGTGGGACTGAAGCTGG - Intronic
1002947727 6:1779017-1779039 GGCTGGGGTGGGAGTGAGGAGGG + Intronic
1003269415 6:4593997-4594019 AGCTGGGGTGGAAGAGAAGAGGG - Intergenic
1003522320 6:6868705-6868727 ATAAGGGGTGGCACAGAAGAGGG - Intergenic
1007400277 6:41599177-41599199 ATGTGGGGAGGGTCTGAGGAGGG - Exonic
1010709808 6:79160956-79160978 ATCTGAGTTAGAACTGAAGAAGG - Intergenic
1010855483 6:80833261-80833283 GTCTGAGGATGGACTGAAGAAGG - Intergenic
1011725300 6:90204875-90204897 AGCTGGGGTGGGGTTGAAGCGGG + Intronic
1012359906 6:98364459-98364481 ATCTTGGGTGGGCCTGCAGTTGG - Intergenic
1014973117 6:127843669-127843691 ATCTGGGAGGGCACTGAACAAGG - Intronic
1015178031 6:130332467-130332489 GTCAGAAGTGGGACTGAAGAAGG + Intronic
1015592628 6:134837089-134837111 AGCTGCTGTGGGAATGAAGAAGG - Intergenic
1019136748 6:169913488-169913510 ATCTGGGGTGGGGGAGAGGAGGG + Intergenic
1019187908 6:170231720-170231742 ATCTGGGGTGGGGAGGAAAAAGG - Intergenic
1019830038 7:3319000-3319022 ATCTGGGGGTGGCCTGAGGAAGG + Intronic
1021193485 7:17648863-17648885 ATCTGGGGTGGAGCAGAATAGGG - Intergenic
1022869896 7:34465882-34465904 GTCAGAGGTGGGAGTGAAGAGGG - Intergenic
1024270868 7:47640396-47640418 AGCTGAGGTGGGGCTGTAGAGGG + Intergenic
1024586405 7:50845656-50845678 ACCTGGGGTGGGTCTATAGATGG + Intergenic
1024858048 7:53804597-53804619 ATCTGGGGTGAGGCTGATAAGGG - Intergenic
1026130080 7:67612897-67612919 ATATGGGGAGGGACTGCAGTGGG + Intergenic
1027519671 7:79189782-79189804 GTCAGGGGTGGGAGGGAAGAAGG - Intronic
1027846590 7:83385626-83385648 CTATGGGGTGGGACAGAAGTAGG + Intronic
1029046776 7:97638492-97638514 ATTTGGGGCGGGGTTGAAGAAGG + Intergenic
1030690148 7:112524049-112524071 ATCTGTGATGGCACTGAAGCAGG - Intergenic
1032754627 7:134877230-134877252 ATCTGGGGTATCACTGAACAAGG + Intronic
1033138449 7:138803985-138804007 ACCTGAGGTGGGGGTGAAGATGG - Exonic
1034349939 7:150409010-150409032 CTCTGGGGTGAGACCGAGGAGGG + Intronic
1034451994 7:151142089-151142111 GGCTGGGGTGGGACTGAAAGGGG + Intronic
1034686063 7:152972481-152972503 GACAGGGGTGGGACTGAAGATGG + Intergenic
1034808192 7:154106795-154106817 ATGTGGGGAGGGACGGATGAAGG + Intronic
1035679355 8:1476787-1476809 ATCACGGGTGGGTCTGCAGAAGG - Intergenic
1035679368 8:1476839-1476861 ATCACGGGTGGGTCTGCAGAAGG - Intergenic
1035679382 8:1476892-1476914 ATCACGGGTGGGTCTGCAGAAGG - Intergenic
1036208830 8:6825677-6825699 ATCCGGGGTGGGACTCAGGTCGG - Intronic
1036769026 8:11566094-11566116 CTGTGGGGTGGGGCTGAGGAGGG + Intergenic
1037319433 8:17629708-17629730 ATCTGAGGTGGAACGGATGAGGG - Intronic
1038361713 8:26886057-26886079 ATTTGGGGTGAGTCTGGAGAAGG + Intergenic
1038611544 8:29064030-29064052 TCCTGGGGTGGGACTGAGGGAGG + Intronic
1039255152 8:35710792-35710814 TCCTGGTGTGGGAATGAAGATGG - Intronic
1042326387 8:67533147-67533169 ATCTGGAATGGGACAGCAGAGGG + Intronic
1044748030 8:95390056-95390078 ATCTGGGAGTGGACTGAGGAGGG + Intergenic
1044758989 8:95496893-95496915 ATCTGGGGTGGGAAGAAAAAGGG - Intergenic
1044828260 8:96219739-96219761 GCCTGGGCTGGGACTGATGAAGG - Intergenic
1048369540 8:133765730-133765752 ATCTGGGGTGGGAATGGGGCAGG - Intergenic
1051136939 9:13933212-13933234 ATCTCTGGTGGAACTGAAAATGG + Intergenic
1053435652 9:38072412-38072434 AACTAGGGTGGGACTGGAGGAGG - Intergenic
1055426491 9:76202159-76202181 ATCTGATGTGGGAGTGACGAAGG - Intronic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1060061317 9:120462731-120462753 AGCTGGGGTGGGACTGGGTATGG + Intronic
1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG + Intergenic
1061800417 9:133110488-133110510 TACTGGGGTGGGACAGAGGAGGG + Exonic
1062185250 9:135214797-135214819 ATCAGGGGTGGTATTGGAGAGGG - Intergenic
1186200190 X:7148478-7148500 ATCAGGGGTGTGAATGAGGAAGG + Intergenic
1188895283 X:35659518-35659540 ATCTGCTGTGGGACAGAAGTTGG + Intergenic
1189180935 X:39004000-39004022 ATTAGAGGTGGGACTGAGGAGGG + Intergenic
1189245768 X:39562098-39562120 ATCTGGAGTGGGGCTGGAAAAGG - Intergenic
1190292528 X:49002058-49002080 TTATGGGGTGGGTCTGGAGAAGG - Intronic
1190391947 X:49940820-49940842 ATTGGGGGTGGCAGTGAAGAAGG + Intronic
1190738722 X:53273299-53273321 ATTTGGGATGGGACAGAAGTAGG - Intronic
1194275308 X:91872871-91872893 ATTTGGGGTAGGACTGATGTTGG + Intronic
1194967274 X:100302917-100302939 ATCTGGGGTGGGACAGTATCTGG - Intronic
1196581261 X:117381808-117381830 ATCTGTTGAGGGCCTGAAGAGGG - Intergenic
1197473457 X:126891276-126891298 TTCTGGGGTGGGATTCAAGAAGG - Intergenic
1197658576 X:129145305-129145327 ATCCAGGGTGGGACTGAGGGGGG - Intergenic
1197857957 X:130937877-130937899 GTTGGGGGTGGGAGTGAAGAAGG + Intergenic
1199596822 X:149512561-149512583 ATCTGGGCTGGAGCTGAAGCAGG - Intronic
1200592553 Y:5094268-5094290 ATTTGGGGTAGGACTGATGTTGG + Intronic