ID: 973870306

View in Genome Browser
Species Human (GRCh38)
Location 4:55159558-55159580
Sequence CACAGTTGGGTGAAGTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973870306_973870311 -6 Left 973870306 4:55159558-55159580 CCAGTCCACTTCACCCAACTGTG No data
Right 973870311 4:55159575-55159597 ACTGTGTCAGTGGCCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973870306 Original CRISPR CACAGTTGGGTGAAGTGGAC TGG (reversed) Intergenic
No off target data available for this crispr