ID: 973872495

View in Genome Browser
Species Human (GRCh38)
Location 4:55180310-55180332
Sequence TGGGAGGTATACAAGTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973872490_973872495 16 Left 973872490 4:55180271-55180293 CCAAATCATTTCTTTTCTAAACC No data
Right 973872495 4:55180310-55180332 TGGGAGGTATACAAGTTGAATGG No data
973872493_973872495 -5 Left 973872493 4:55180292-55180314 CCTCAACACTTTTGAGAGTGGGA No data
Right 973872495 4:55180310-55180332 TGGGAGGTATACAAGTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973872495 Original CRISPR TGGGAGGTATACAAGTTGAA TGG Intergenic
No off target data available for this crispr