ID: 973872921

View in Genome Browser
Species Human (GRCh38)
Location 4:55184752-55184774
Sequence AGCCCAGGTGTTGCACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973872921_973872926 13 Left 973872921 4:55184752-55184774 CCTGTGGGTGCAACACCTGGGCT No data
Right 973872926 4:55184788-55184810 GAAATGTCCTGGCCACTAGATGG No data
973872921_973872923 2 Left 973872921 4:55184752-55184774 CCTGTGGGTGCAACACCTGGGCT No data
Right 973872923 4:55184777-55184799 TAGCACCCTCTGAAATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973872921 Original CRISPR AGCCCAGGTGTTGCACCCAC AGG (reversed) Intergenic
No off target data available for this crispr