ID: 973872926

View in Genome Browser
Species Human (GRCh38)
Location 4:55184788-55184810
Sequence GAAATGTCCTGGCCACTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973872918_973872926 23 Left 973872918 4:55184742-55184764 CCTCGCATCACCTGTGGGTGCAA No data
Right 973872926 4:55184788-55184810 GAAATGTCCTGGCCACTAGATGG No data
973872922_973872926 -2 Left 973872922 4:55184767-55184789 CCTGGGCTAATAGCACCCTCTGA No data
Right 973872926 4:55184788-55184810 GAAATGTCCTGGCCACTAGATGG No data
973872921_973872926 13 Left 973872921 4:55184752-55184774 CCTGTGGGTGCAACACCTGGGCT No data
Right 973872926 4:55184788-55184810 GAAATGTCCTGGCCACTAGATGG No data
973872917_973872926 24 Left 973872917 4:55184741-55184763 CCCTCGCATCACCTGTGGGTGCA No data
Right 973872926 4:55184788-55184810 GAAATGTCCTGGCCACTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973872926 Original CRISPR GAAATGTCCTGGCCACTAGA TGG Intergenic
No off target data available for this crispr