ID: 973874520

View in Genome Browser
Species Human (GRCh38)
Location 4:55203515-55203537
Sequence CCAATTTCTCAATATAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973874520_973874524 17 Left 973874520 4:55203515-55203537 CCTGATTTATATTGAGAAATTGG No data
Right 973874524 4:55203555-55203577 GATGGTAAGTCCAAAATCTGCGG No data
973874520_973874529 30 Left 973874520 4:55203515-55203537 CCTGATTTATATTGAGAAATTGG No data
Right 973874529 4:55203568-55203590 AAATCTGCGGGTAGGCCAGTGGG No data
973874520_973874522 -1 Left 973874520 4:55203515-55203537 CCTGATTTATATTGAGAAATTGG No data
Right 973874522 4:55203537-55203559 GATCACATGATTCCAAAAGATGG No data
973874520_973874525 18 Left 973874520 4:55203515-55203537 CCTGATTTATATTGAGAAATTGG No data
Right 973874525 4:55203556-55203578 ATGGTAAGTCCAAAATCTGCGGG No data
973874520_973874526 22 Left 973874520 4:55203515-55203537 CCTGATTTATATTGAGAAATTGG No data
Right 973874526 4:55203560-55203582 TAAGTCCAAAATCTGCGGGTAGG No data
973874520_973874528 29 Left 973874520 4:55203515-55203537 CCTGATTTATATTGAGAAATTGG No data
Right 973874528 4:55203567-55203589 AAAATCTGCGGGTAGGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973874520 Original CRISPR CCAATTTCTCAATATAAATC AGG (reversed) Intergenic
No off target data available for this crispr