ID: 973874522

View in Genome Browser
Species Human (GRCh38)
Location 4:55203537-55203559
Sequence GATCACATGATTCCAAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973874520_973874522 -1 Left 973874520 4:55203515-55203537 CCTGATTTATATTGAGAAATTGG No data
Right 973874522 4:55203537-55203559 GATCACATGATTCCAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973874522 Original CRISPR GATCACATGATTCCAAAAGA TGG Intergenic
No off target data available for this crispr