ID: 973881266

View in Genome Browser
Species Human (GRCh38)
Location 4:55273641-55273663
Sequence TAGTGGTGAAAAGCTTTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973881260_973881266 -5 Left 973881260 4:55273623-55273645 CCTAGTCCAATGGGACCATAGTG No data
Right 973881266 4:55273641-55273663 TAGTGGTGAAAAGCTTTGCGGGG No data
973881259_973881266 -4 Left 973881259 4:55273622-55273644 CCCTAGTCCAATGGGACCATAGT No data
Right 973881266 4:55273641-55273663 TAGTGGTGAAAAGCTTTGCGGGG No data
973881258_973881266 -1 Left 973881258 4:55273619-55273641 CCACCCTAGTCCAATGGGACCAT No data
Right 973881266 4:55273641-55273663 TAGTGGTGAAAAGCTTTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973881266 Original CRISPR TAGTGGTGAAAAGCTTTGCG GGG Intergenic
No off target data available for this crispr